GenePrediction:GLEAN_7783 Details

Name: GLEAN_7783
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:3049394..3048173 (- strand)
Length: 1222
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:3049394..3049266 (- strand)
Length: 129
Type: CDS
Source: GLEAN
Position: GCSC_113:3049207..3049099 (- strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_113:3049032..3048173 (- strand)
Length: 860
>GLEAN_7783 class=GenePrediction position=GCSC_113:3049394..3048173 (- strand)
ATGGTCGGGACCTGGACGCCCCCAGGTGCCATTTTCACAGTCGAGTTCGATGATGAGACTCTTGAGCTTCGGCTCATCAG
GAGGACCGAGATCCCGCACGACGAGCCGATCTCATGGATGGCTTTTGACGTAAGAAACACATGGCCTGGGATCGGTGAGA
GACGAAATGCTCACGTACCCTGCCCAGCACGCCAAGAAAAACCTCTACGGATCGGCCATGAAGAAGTGGACGAGCTTTGC
AGTCAATAGCCCGACTGAAATCGTACACCAGGCATCACACCCCATTGGTGGTGACCGTGAGAAACGCCTAATGTCCCCGA
GATGATTTTCCACCGTTTATTTCTAGACTGACGACCCGACAGCGGAGGCACAATCCAGCAGCACGAACACAAGGGCCATT
TTCCTGCTGCCGGCCCGGAAGCCGCCGTTTGCGGTGTATTGCAACCCTTTCTACAAGCATGCAGGCTACGGAAACGTGTT
CAGCGTCGGCCCCTCCGGAGAGCTGCACGAAAACGTGCAAAACTATGCCTACCAGCCAAATTCTGGGATCCACGGCATGG
TCTTTGACCCGACCGAGACGTACCTGTACTCGGCCGACCTATCTGGCAACAAGATCTGGGTGCACCGGAAGCAGACGGCG
TCGGAAGCATACGGCGGCCAAGTGGAGCTGGTGGGATCTGTCGATGCGCCGTCGGCTGGCGACCACCCGCGCTGGGTTGC
CATGCACCCGTCGGGCCAGTATCTATACGCACTGATGGAGGCGGGAAACCGTCTGTGCGAGTACGTCATTGATCCGGCCA
GCCACCTGCCTATCTACACCCATCACGCCTACCCGCTGATTCCGCCTGGCATCGAGACGCGCGACCGAGTGACCGGGAAA
GGCCTGTACCGCAGCGACGTCTGCGCGCTCGACCACAGCGGCCGCTATCTCTTTGCCACGGCGCGTGCGAATAGCTTCGA
ACTCACGGGGTACATTTCCGCCTTCCGGCTGCACAGCTGTGGCAGCATCGAGACGCAGGTCTGCCTTAACCCCACTCCCA
CGAGCGGCGGCCATTCCAACGCTGTCAGTCCGTGCGACTGGTCCGCCGAGTGGCTCGCCCTCACCGACGACCAGGAGGGC
TGGGTCGAGATATACCGGTGGCACGAGGAGTTTCTGTCAAGGGTGGCACGCGTGCGCATCCCCGAGCCCGGGTTTGGCAT
GAATGCCATCTGGTATGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62