GenePrediction:GLEAN_7784 Details

Name: GLEAN_7784
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:3047603..3045327 (- strand)
Length: 2277
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:3047603..3046311 (- strand)
Length: 1293
Type: CDS
Source: GLEAN
Position: GCSC_113:3046239..3045698 (- strand)
Length: 542
Type: CDS
Source: GLEAN
Position: GCSC_113:3045630..3045327 (- strand)
Length: 304
>GLEAN_7784 class=GenePrediction position=GCSC_113:3047603..3045327 (- strand)
ATGGACTATGACGATGGAGCTGTGACTGACGATGCCATCCAAACCGGGCTTCCTCTAGCTCAGTCTGCAGCCGCTGCCAC
CCAGGAATTGACTGCCAGGCTGGCTCCCTCGCCCTCGACCAAGACGCGCTCTTTATCGGACGGAGGATGCAGCACGTCCA
GCTGCCGCAGGCTGTCTCCGCCGCCGTTGTTCCTCGATCCCAACACCCGACGGACATGCAGGGATGATAGTTTTATTGGC
AGCTCGACGGTGGATACCGTACCGGTCACCCCCAGACGTCCGTCCTCGTTGCAATATCGGGGTGCTTCCCTGCAGCTGCC
AGCCAGCCAGCCACCATCAGCCCAGCAGCCACAACATCCGTCTACGCCTGCTTCTAGTAGCAGTGCACATATCTTGCAGC
AGCAGCAGCAGTTCTTCCTCAACCAGCCTACGTACATGGCAAAGCCGACGCCGCTCTCTCCGAAACTCGATCCCTCTCAG
ATCTATGCGTCCCCTACAAACATCCTGCCACGCCGATCTCGCGGCCTCGATTTTTCACGGGCGGCCACCAGCCTGCACCA
CTCGACTCTCGCAGAGCAGTCGTCACCCGACTCGTCACCTCTCGTTTCCGGCAGCCACGCGGCCATGAACATTCCTGGCA
GGAAGCCTGGCGATTACGGAGGTGCCACCGAGTCATCCACATCGCTGTGGTCGATGATGGGTCGCAGCCAGGAGAAGGCG
CAGCCGTCGGGGTCCCTGGGTAGCGTCAATTACGCTTGCTCCGACTCGTCGTCCAGCTCTGACGACAACGACCTGATGGA
CGAGGACTTGGATGAGCCGTTTGTCACGACGCCGCAGGTCGGCAGGGTGACCACGCCATCGATGACGCCGACGGCGCCTT
CCACCCAGTCCTGGATGCCAGGCTCGCCCGCCATGAACAGCCTGCTGTCCTTTCAGAACCGCCAGCGACCACGGAAGCAG
CCCAGACGAAAGGTGCGCGGGCCCCTTGGCTTAGGATTCAGCTCCATCTTCACCCCGCCGCCGGCTGCATCGCCCGCGGG
CATGAGCACGTTGTCCAGGTCTCCGCCTGGCTACATACTGGGACGAGATGGCGGGACCGTGGCGGCACAGCAGTCACACG
CCCGTCGGGAGAGTATCAGCTGGGCCGCCAACCAGCTGCATATCTCGGGAAGCGAGAGCGACGATAGCCCGAAAGCACAC
ACCGAGGCTGGGGAAGGGCCCGTCTTGACGCCCGGCCGTGATGGCCAGCGGGGAGTAGTCCGTCGTGTGGTGACGCGGCG
TGGAAACCTTTTGGTACGCCGACGCTCCCGGTGTCTCCCCTTGACGGCAGATGGTGTAGCTGACAGTCGCAGCCGAAAAC
CAAGGGCTTCGCACGGATCCGGGCCGCGCTCGCTGAAGAGAGCACGCCGGTGGAGTCGGACTTCCGACGCGAGGCCGAGG
TTGTTCGCCAGGTGCTCGAGAGCGACATGGAGCCCGAGCTGCTCCGGCCGCGGCCTCCGCCGCCCCTTCGGTCTGTGGCG
ACAACGCCCAACTCGAGTCCGAACATGCCAGAAAACCTGGACGACCTTGCGGACGACGTTATGGCCATGGATGCAGCCTC
GGCCGGTCTGGGGCTCTCGGTGGGTGCCAAGTTGCCGACCGACAGACGTCGTGCCCGGAGCCCGTCGATGTGGGCAAACC
TTGGTCTTCACGGCGCCTCTGCACGCACAACGCCGCCGCGCCAGCCCTCGTGCCTGTCACCTGACGATGTTTCGATGGAC
TCGCCTCTGGGGACCGGCTCAGGCTCGAGCAGCAACATGGTCTTTCCGAGCGGCGCAGTCTTCGCCCTGACGGCCAGCTC
CTCCAGAGGTGACACGCCACAGCCGGGCCTTAAGGGGACATCAGCAGCACCAGCCGGTCCTGCCAAGTGCTGCGGAGATC
ACGCGCCGCATCAATAGCAAGCGACGTCGTGACGACGACCTGGATCCGGTCAGTTTCAAGCGCCGTGCCGTCAGCCCGGG
CATGAGCGTGCACAACAGTCCGATCACGCAGAGCCCGCTGCAGCGGGACACAATGCCGTGGGGCGGTCCGTCGTCGCGAC
CGGGAAGCAACAGCGGAAGCTTGGACGCCAAGTTCTTCCCGCCGCTGCCAATCAGTGGTATCAGTGGTGGCAGCGGAGGC
GCGATCTTGGCAGACGGCACTGCGGGTGTCAATCGAGCCGGTGGCAGCAAGGGCCGCGTAGGATACCAGACCATGGCGGA
TGCCAACGATAGCATCACGCGTCTGAGCATCGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62