GenePrediction:GLEAN_7785 Details

Name: GLEAN_7785
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:3042022..3040423 (- strand)
Length: 1600
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:3042022..3041577 (- strand)
Length: 446
Type: CDS
Source: GLEAN
Position: GCSC_113:3041509..3040423 (- strand)
Length: 1087
>GLEAN_7785 class=GenePrediction position=GCSC_113:3042022..3040423 (- strand)
ATGGCCTTGTTTGAGTCGGCTCTGCGCCGGACAGCTGTCCTGGTCGCGCGGGTGCCTGTGTCCTGCAGCAAAGGCTTGCG
CAATGAGCAGATGCCCCAGCTCTCGCAGATGTTGCGCCAATTGTCTCAGCCGTCGCCGTTTCAGAGCCGGTTTAAATCTA
CCATAGCTGTGCCTGTGCGCCGCCCAAACAGCCGTGCCGCCTCCATGTCGCCGGGCTTCTTTGCCCAGGCCGAGAGGGCC
ACGTGTCTGTCGAGGTCTCTCGCAACGGTTTTCGCTACTGCTTCTCCTGCTACTACTACTACTGCTGCATCCTCGACTGG
ACCGGACAAAGAGGGCTTCTTCCCAGAGACGTCCTCCAAGGCCGTCGCCTACTGGCTCATCGGAAGCGCCATCAGCGTCT
TTGGCATCGTTGTCTGGGGCGGCCTGACTCGGCTGACTGAATCTGGGTAAGACCACGGCTTCAGACCCCCCCCAAACGCC
CCCATATCACCTCGGAACTGACGTCCTGTATAGCCTCAGCATCACGGAATGGCGTCCGGTCACCGGTGCTCTCCCGCCTC
GCTCAGAGGCCGAGTGGGAGGCTGAGTTCACTCGATACCGTGCCAGCCCTGAATACGCCCGTCTGAACCCGCACATGACC
CTCGACGAGTTCAAGAAGATCTACTTTATGGAATGGTCGCACCGTCTTTGGGGCCGCCTGATCGGCCTTACCTTTGTCGC
CCCGGCCCTCTACTTCGTTCTGCGCCGCCGTGTGGCCAAACCCATGGCCTGGCAGCTGTTTGGCATCGCCGCCCTCATCG
GCTTCCAGGGCTTCATCGGCTGGTGGATGGTCAGCTCCGGCCTGCGTGAAGAGCTGTTTGCCCCTGGAGCACACCCCCCC
CGCGTGTCCCAATACCGCCTGACCACCCACCTGGCCACCGCCTTTGTGTGCTACTCTTGGATGATGCTGGCCGGTCTGGC
CGTCTTGCGCGATATCCGTCTCCGGGCAGATCCAGCTGCCGGTGCCCGTTTGGCTTCCGTGCTCGCTTTGCCGGCCCTGC
AGCCGTTCCGCCGCTCTGTCGCCGTGCTTACAGCCCTCATCTTCGTCACTGCCATGTCTGGCGCCCTCGTTGCCGGTCTC
GATGCCGGCCTCATCTACAACGAGTTCCCCATGATGGGTGTCGGCCTCACGCCACCCAAGGACGAGCTCTGGGATCCTCA
CTACGCCCGCAAGGCCGATCACGCCGATCTTTGGTGGCGCAACATGCTCGAAAACCCCTCGCTCGTTCAGCTCGACCATC
GTATCCTCGCCACTACTACCTTCTGCTCCGTCCTCGCCCTCTTCGCATATGCTCGCCGCGGCAACGTCGCCGCTCTCCTG
CCGTCCAACATCAAGCGCGGCACCACCGGCCTCGTCCATCTCGTCCTCCTTCAGGTCACCCTGGGCATCGCCACCCTCAT
CTACATGGTGCCCACGCACCTTGCTGCTACCCATCAGGCCGGCAGTCTGGCCCTCCTGACTGGTGCCCTCGTGCTGGCTC
ACCGCCTGCGCATCCCCAAGTCCAGCTTGCGCATCATCCAGCGGCAGCTGGAAACGGCCTCAAAAGCCTCGAAACCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62