GenePrediction:GLEAN_7786 Details

Name: GLEAN_7786
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:3031328..3030060 (- strand)
Length: 1269
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:3031328..3031319 (- strand)
Length: 10
Type: CDS
Source: GLEAN
Position: GCSC_113:3031215..3030909 (- strand)
Length: 307
Type: CDS
Source: GLEAN
Position: GCSC_113:3030819..3030783 (- strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_113:3030716..3030631 (- strand)
Length: 86
Type: CDS
Source: GLEAN
Position: GCSC_113:3030551..3030197 (- strand)
Length: 355
Type: CDS
Source: GLEAN
Position: GCSC_113:3030110..3030060 (- strand)
Length: 51
>GLEAN_7786 class=GenePrediction position=GCSC_113:3031328..3030060 (- strand)
ATGCCTCCCGGTATGTTGTAGATAATCACAATGCATAGCACACGGCGCATCCTCACTAGACGCAAACCTATCCCGCATGA
ACCCAATGAACATCAGAGACTGACCGCTTACAGCTCTCAGTGACGATGAAATGTCAGATTCCAGTGGCGTGGGGGCTGTA
ACCACGCCGCCGCCGTCAAAGCGAGGAAAGAAGGTCGGCTCTTACGCTAGCCTCAATACCGAAAATTCAGACGAAGCTTC
AGACAGCGCGCAAGCCAAGAAACGAGGTGCGCCCAAGACTTCTGCACGAACAAATGGTTCTGCAGCGGCCAGATCCATCC
CGATCAGGAAGGGCAACGGCACAGAAGACGAAGCGAGCAAAAACGGAGTCACCGACGAAAACGGCGATGATGGCAGCGAC
GACTCAGAAGCAGAGGAAGAGTACGGCCGCCAGCCTCGTTGCCTTCGGGCACACCAGCATTGGCGCGCCTATGACTCTTG
GAACAGTGATGCTGACGCCCCGTTTCTAGGTATGAAGTTGAACGCATCATCGGCCACATGCTCAATGTAAGTGAAACGTG
ACCCGCCCATGTGCACTCAATGTACTTTGTGTCTGACATCGTATTTTTAAAGGATGCGGGCGATCTCTTATTCCACGTGA
CGTGGAAGGGATACAACAACCCCAAGGACTATACTTGGGAGCCAGAGGAGAACCTAGCGTAGGCACTGATATTTTGGGGC
TGCATTGGTGGGTTGTAGGCTCCGCCAGGATACTTTACTAACATGGTATCTCGGCAGTGGCAATGCGTCGGAGATCCTTA
ACGAGTACATCGCCAAACTCGGCAGTCGCGAGAACCTCTTTGAAAAACCGAACAAGGGGAAGAAGCGCGGGCGTCAGTCC
TTGAGCGCAACAACACCGGCATCAATGCCGCCAAAACGGACGAAGAAGAACGGCGAACACCCGGCAGACCGCGAAACACC
TTTGGCCGTGGAGAACCCGTTTAAGCCACCTGCAGGGAGTTGGGAAGACGATGTGGTGGACGTGGAAATGTACCGGAATG
GCGAGGGGGAACTCATTGTCTGCCTAACGTGGAAAGCCGGACAGAAATCACAGCATCCTGCGCAACAGACGTATATGCGG
TGTCCTCAAAAGGTATGTCGAAATTAGTTACCGATGTGGCGGTAGGCAACATGGTCGTGAATCGCAACCTGTACTAACTT
TGGGGCGATGTGATCTAGATCCTCCGATTCTACGAATCACACATTAGCTTCAAAACCGACACTGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62