GenePrediction:GLEAN_7787 Details

Name: GLEAN_7787
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:3024003..3022220 (- strand)
Length: 1784
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:3024003..3023775 (- strand)
Length: 229
Type: CDS
Source: GLEAN
Position: GCSC_113:3023724..3022359 (- strand)
Length: 1366
Type: CDS
Source: GLEAN
Position: GCSC_113:3022280..3022220 (- strand)
Length: 61
>GLEAN_7787 class=GenePrediction position=GCSC_113:3024003..3022220 (- strand)
ATGCGCCGTACGTCTGTCTCGCTGCCGACGGACAAGATCGCTTTCGACCCGCACGAGAAACCCGCCCGGTACGGCTCGCA
CGCTCCCAAATCCACCAAGCTGGAGCGCTTTACCGCCTGGATGTCGCAGGCCAAGCAGACGCGCTGGATCAAGGCTGCTG
CCGTCCTGTCGGCCGTCTTTTTCCTCTTCTACTACTTCTCCCCACAGGGCGTTGATCTATACCGTGGAGGTGCGCTTTCT
TTGCCCAATCCATCCTTCTTCCTCACTAACGAGACTCAGCATCTTCGCCTAGCGATGGACAGGTTCCTTCAGACAGCACT
TACGGCACCAGCCGGTGTACGCGCTCGAGCTCCCACGAGAAGCCCATCGTGCAGTATGTCATGATGATCGATGCCGGCAG
CACGGGTTCCCGTATCCACATCTACAAGTTCAACAACTGCGGTGCCACCCCGGAGCTCGAAAGCGAGGTCTTCAAGCAGA
CCAAGAAGATTGATGGCCAGAGCAGTGGTCTCAGTGCCTACCCCGATGACCCAGAGGGTGCTGCCCACAGTCTGGACTCG
CTGATGGAGGAGGCCCTGAGTGTAGTGCCCGACAAGCTCAAGGCCTGCAGCCCCATTGCTGTCAAGGCCACGGCTGGCCT
TCGTCTGCTTGGTCCTGAGAAGAGCCAGCGCATCCTCGACGCCGTACGGAAGCACCTCGAGCAGGACTACCCTTTCCCGG
TCCTGGCGGCCGAAGAGGGTGGCGTGGCCATCATGGACGGCTCAGACGAGGGCGTGTACGCCTGGATCACGACGAACTAC
CTGCTGGGCAACATCGGCATGCCGGAGCATGAAGAGACGGCGGCCGTCTTTGACCTCGGCGGCGGCTCTACCCAGATCGT
GTTCGAGCCGAACTACAAGGGCCTCACCCAGGGTGGCATTCCCACCACGATGGCCGAGGGAGACCACAAGTACGACCTAG
ACTTTGGTGGCCGCCACTTCACCCTCTACCAGCACTCCCACCTGGGCTACGGCTTGATGAGCGCTCGGGAGGCCATTCTC
AAGGAGCTTGTGGACGACCTGCTGGCGGCCAACAAGGACGCCACGACTACCGCTTGGGCTAAGGCCCCTGTGGTGAACCC
GTGCTTCGCCGTGGGCATGCAAAAGACGGTCAAGGTGAAACTGGGCGACGACCACCCGCTGGGCGCCCAGGCCGAGTTCA
ACATGACGGGTCCTACCAAGGCAGCACCGGCGCAGTGCCGCAACCTGGCAGAGCGGATTTTGCGCAAGGAGGCCGAGTGC
AAGCTGGCACCCTGCTCGTTTAACGGCGTGCACCAGCCATCAATTGCCAAGACGTTTTCCAAGGAGGCCGTGTACTTCCT
GTCGTACTTCTTCGACCGCACGCAGCCGCTTGGAATGCCGGAGTCGTTTACGCTGCGGGAGATGCACGAGCTGGCAAACA
CCGTGTGCAGTGGGCCGGCTGCCTGGGACGTGTTCTCGGCCGTCCCGGGCGCGCTGGAGGAGCTGGACGGCCGTCCGGAA
CACTGCATGGATCTCAACTTCATGCTGGCCCTGGTGCACACTGGTTACGAGATGCCGATTGATCGTGAGGTGCGCATTGC
CAAGAAGATTAAGGACAACGAGCTCGGTTGGTGCCTGGGTGCAAGGTATGTTTTCAGCTTCTCCGCCTCTCTCATCTCAT
TATTGTTCTTTTTGTGCCACATAATGCTGACTATATATCGAAGCCTGCCGCTGCTGTCCAAGGGATCGGGCTGGGCCTGC
AAGGTCACCGAGGTTCACCGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62