GenePrediction:GLEAN_7788 Details

Name: GLEAN_7788
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:3019772..3016441 (- strand)
Length: 3332
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:3019772..3019743 (- strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_113:3019677..3019624 (- strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_113:3019548..3019453 (- strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_113:3019388..3019164 (- strand)
Length: 225
Type: CDS
Source: GLEAN
Position: GCSC_113:3019095..3018996 (- strand)
Length: 100
Type: CDS
Source: GLEAN
Position: GCSC_113:3018917..3018815 (- strand)
Length: 103
Type: CDS
Source: GLEAN
Position: GCSC_113:3018033..3017955 (- strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_113:3017892..3016864 (- strand)
Length: 1029
Type: CDS
Source: GLEAN
Position: GCSC_113:3016798..3016757 (- strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_113:3016695..3016441 (- strand)
Length: 255
>GLEAN_7788 class=GenePrediction position=GCSC_113:3019772..3016441 (- strand)
ATGGCGTCAAGGAAGAAGGTTCTCTTGAAGGTATGGGGCGATCCTATCAAGCTGAATGCTTTTCTTGTGCTAACAATGGC
TTCCCGCCTTTCCAGATCATCATTCTCGGTGACAGCGGTGTGGGCAAGACCAGCTTGATGAACCAATATGTATGCAACCC
GAAGATGTATGCAGCCAATTGAGAGAGTCATCATAGGAGACGCTCACACACAATTCCATCATAGGTCAACAAGAAGTTCA
GCGCAAGCTACAAGGCTACGATCGGAGCGGATTTCCTCACACGAGAGGTCCCTGTTGACGATCGGCAAGTGACCATGCAG
GTGGGCATTACCTCATACCTTACATGCAAGGTAAATGGCTGATGGCTGGCTAACGATCGTGTAGCTTTGGGACACCGCTG
GCCAGGAACGGTTCCAATCATTAGGCGTTGCCTTCTACCGCGGTGCTGACTGCTGCGTTCTTGTCTTTGATGTGAACAAT
GCCAAGAGTTTCGAAGCCATCGAGGGCTGGCGCGACGAGTTTTTGGTACAGGCCTCGCCTCGGGATCCGGACAACTTCCC
CTTTGTTGTGCTGGGTAACAAGATCGACGTGGAAGAAAGCAAGCGTGTGGTACGGCAACGATCCCCTTCATACCACCAGA
AGCTGCCCAGGCACTAACTCTTTTTTTCTCTTTCTAGATTTCTACGAAGCGAGCAACGACCTTCTGCCAGGCACATGGGA
TTCCATACTTTGAGACAAGTGCCAAGGAGGCCATCAATGTGGAGCAAGCATTCGAGGGTAAGATTTAGAAGGAAGGAGTG
ACAGATGGCGATATACAGGCAGTCGGCACAGCAGTACTAACCCAATTCTGTATAGTTATCGCCAAGAACGCGCTGCAGCA
GGAGGAAGCGGAGGAGTTCAGTGGCGACTTCCAGGACCCGATCAACATCCATATCGAGAACGACCGGGACGGATGCGCGT
GCTGAAGAGACGGAGCGCGGCAAAGCGGGGAGGAAATGTGCGTCAGCCACGCTGTCTTGCGATAGCAGTATGAGCCACTG
GTGTGGCTGTCGGGGCGACTGCCTGTGAGAGTGAAGCTCCAGATGCGTCTAAGATCGATCCATTTTTTCTCTTTTTTTCT
TTCTTTGTTTGGCCTCGACCGGGCACTCTTTTGGATGAGGACGGCCAGAGCATGTGCATTTTGAGGCAGGAGGAGTGCGG
GAGGAACATTGGGGCCACAGATGGTATCTTATTTACAATATCCACACTACAAGTTTAGTTGCTCGCTTCGATAGAGCAAT
CTGCACCATACTGACTTGGTGGGCCGAGCGGCTTCGCAACGAAACTGAAACATAGCCGATGCTATAGACCAGCCAATAGG
GCGTTAGAGATAGGCCATCGAGCCTCAAGTCTGCCAAGACGCAGCAGTGACCTCTCTGACAACATAAGCTCATGCCTGAC
GTCTTCTGCTGGATCTCCATTCATCATCTCCATCGTGTTCTACTCTCCAATTTTCGCTGCAAGATACGCTATCTGTTCGA
GCCGACAACGTCCTGCTCTTACGTGCGACAGTGCTGACTCATCATGATGCTTATCGCATCTTGCTCAACCTAGGCTGGCA
TCTTACTAGAGAACCAACACCACTTTGCAGACCGTCCATTGTTGATCCTCGCTGCAATAATGACGTCCGCTACTCCTCGC
GATGCCGGCCCGGCTGCGGCCGGAAGACCGGGATTTCGCTCTAGCATTGGCTTGGGTAGTGTCGCGCGCCGCACCATAGG
TATCAGCATGCTGATGGTGACCGTTTTCCTGTGGACGGCCTCCAATTTCATGACCAGTGTATGCGCTCTCGGCTAGTTCG
GTTCTTCCAGGCTTCTTCTGCTAATTCTTTTGTCCGGAAGTATGTCTTCTCCGACGATGCGTACAGCAAGCCATTCTTTA
TCGTGTATCTCAACACGTCCGTCTTTGCCATATCACTCATTCCTATGGCCCTGAGGTTTATGATGGCAAACGGTGCCCGG
GCTTCGCGTCATGCCACGCATCAACTCCTTAAGGGCTTATACTGGGATATCCGGAGGACAGTGACACGCAATGGTCGTAG
GGGTAGTGGCGGCGATGACATCGAAGATGCTGACAGCGCCCGGAAACTGCTCAACGAGGACGAGGATGACGAGGACGACG
AGGACGGTGGGATTCTGCGCGATAACCGGTCTCATCGTGGTGGCAGTGCCGCTAACAGGGAATTGGTATCCGCTACCGGC
CGTGATGGCTATAACGAGCAGTTCGTCGACGACCACAACAACAGATACGGTATTGTGGAGGGAGTGTTTGCGACCGATGC
CGTGGACTCGGACGGCGGCGACGAGATGGGGTTGGAAGCCGGCATGGGGACTAGAGAGATGGCCGAAGCTCCCGGAGCAG
ATACCTCTTCGTCAGAGAAGCTGAGCTTGCGTGCGACCGCCTGGCTCAGCCTCGAGTTTTGCATGTTGTGGTTCCTGGCC
AACTATTTCGCTGTTGCCTGTCTCGAGTATACGAGCGTGGCTAGTGCTACTATCTTCACGTCGCTCAGCGGCGTGTTCAC
TTTGCTGATGTGCTCGCTGGCCCGCGTCGAGAGCTTCACCGTGCGTAAGCTGGTGGGCGTGCTGGCGTCGCTTGCTGGCG
TGGCGCTGGTCTCATCGGTCGATCTGTCGGGCAAGAGTGACGAGAACCGGGGCGACTTCCCGCACAAGACAACGGGCGAG
ATCGCAACGGGCGACGCTATGGCGCTGCTGAGCGCAGTGGTGTACGGCGCGTATGTGACGGTGATGAAGCAGCGCGTGGG
CCACGAGGACCGGGTGGACATGTCGCTGTTCTTTGGTCTAGTTGGCCTATTTAACGTGGTCTTCCTGTGGCCGGGTTTGT
TATTGCTGCACGTGACTGGCATCGAGCCAGTAAGTGCTGACATCTTACGATTCAAAATGAGAAGGAATGACTCGTTTGTG
CTGACTTGCTCTAGTTCGAACTGCCGCCCACAGGTCATGTGTGGGCCATCATCTTGGTCAGTTATACGAGCACATCTGTA
CTCAATACATCGGCCCTCCTTGCTAACCCCTGCGCAGACCAACTCCTTGTCCTCCTTCCTCAGTGACTTGACCTGGGCAT
ATGCCATGCTGCTCACCACCCCACTCGTTGTCACTGTTGGCCTATCACTGACCATTCCGCTCTCGATTGTCGGTGAGATG
TTTCAGTACGGCCGGTATGCTAGTTTCACCTACTGGGTAGGCGCCTGCATCGTCGTCTTTTCGTTCTTGTTTGTCAACAA
TGAGAGCCAGGAAGTCGACAATGCAGAATCGCTAACCGAAGAGCAAGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62