GenePrediction:GLEAN_7789 Details

Name: GLEAN_7789
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:3012701..3009912 (- strand)
Length: 2790
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:3012701..3012534 (- strand)
Length: 168
Type: CDS
Source: GLEAN
Position: GCSC_113:3012459..3010608 (- strand)
Length: 1852
Type: CDS
Source: GLEAN
Position: GCSC_113:3010544..3010085 (- strand)
Length: 460
Type: CDS
Source: GLEAN
Position: GCSC_113:3010008..3009912 (- strand)
Length: 97
>GLEAN_7789 class=GenePrediction position=GCSC_113:3012701..3009912 (- strand)
ATGGCCGTGCAGAAGAAACACGGAAAGGGCCGTTTGGACAAGTGGTATAAGCTTGCAAAAGAGAAGGGCTACCGGGCCAG
AGCAGCGTTCAAGTTGATTCAGCTGAACAAGAAATATGGCTTCCTCGAGAAGAGCAAGGTCCTACTGGATCTCTGCGCTG
CGCCAGGAGTACGTGTCCCTATATTCCCATGGTTCGATCGTATGTTCTTCTTGACCCTTGCATTCTAATGCGCGTTGTGC
AGTCCTGGTGTCAAGTCGCTGCAGAGACCATGCCAGCGAACAGCATTATCGTGGGAGTAGATCTCTCACCGATCAAATCA
ATTCCGAAGGTCATCACCTTCCAGAGTGATATTACTACAGAGAAGTGCCGAGCAACAATTCGCCAACACCTGAAGACATG
GAAAGCAGACACCGTCCTGCACGATGGTGCGCCCAACGTCGGTACTGCGTGGGTCCAGGACTCGTTCAACCAGGCAGAAC
TGGCTTTGCAAGCTATGAAATTGGCGACCGACTTCCTCATCGAAGGCGGCACATTTGTTACCAAGGTCTTCCGTTCCAAG
GATTACAATTCGCTTCTGTGGGTGTTCAATCAGCTGTTCACAAAGGTAGAGGCCACCAAGCCGCCATCGTCCCGTAACGT
TTCGGCCGAAATTTTCGTGGTGTGCCGCGGCTTCAAGGCACCCAAGCGAATCGATCCTCGGTTTCTAGACCCCAAAGCTG
TGTTTGCTGAGCTAGCTGATCCAACCCCGAATAACGAGGCGAAGGTGTACAACCCGGAAGTGAAGAAGCGCAAGCGAGAT
GGTTACGAAGAGGGCGACTATACGCAATTCAAGGAAATGCCGGCCAGCGAATTTATTCAGACCACTGATCCCATTGCCAT
TCTTGGCCAGTACAACCGACTATCGTTTGAGCAGCCCAAGAATGGTGACGTGGCCTTAGCTGCCCTCGACAAGCTACCAG
AGACGACCGAGGAAATCCGTCTGAGCTGTGCCGACCTGAAAGTGCTGAGCCGGAAAGAGTTCAAGGTCTTGCTACGGTGG
CGGCTGCGGGTACGAGAGCTCTTTGGGTTTCCTTCGAAGAAGACCGCGGCGAAGCCACTGTCAGAGGAGGTCACGCAAGT
GGACACTATGGACGAGGAGATGAAAATCCAGCAAGAACTCCAGGCCATGAAGGACAGAACGGACTCGAAGAAGAAACGCG
AGAAGCGGAAGGAAAACGAGAAAAAGCAAAAGGACATTGTGCGCATGCAGATGAATATGACTGCCCCGATGGACATCGGC
ATGGAGCAAGCGGACGCAATGGGCGATGGGTCTATGTTCGCCCTCAAGAAGCTACAAGAACCGGATGCCCTTCGGAGAAT
AGCGAAAGGAAAGATGGCGTTTCTTAATACGGACAAAAAAGTGGACCGAGACAGTGGTATCGGATCGTCTGGGGAGACGG
ACAACGAGAGCGACGAGGAAGAGGACCGGCTAGAGCGGGAGCTGGATGGCTTGTATGACGAGTACCAGGATCGGAAGTCG
TCTGCAGATGCGAAGTATCGGGCCAAGAAGGCGAGAGAGCGCAAAGGCGACGACGATTGGGAGGGCTTCTCTGGCGAGGA
CAAAGATATCGAGGACAGCGATGGCGATCTTGAAGAAGACAGCAGCGATGATGATGACGATACCGCAGGCGGAAAACCAA
CAAAGTCTCTGCTTACAGACCTCGACAACGGGCCGGACGAAGAAGGAGGGTTGTCTAAACGAGCCAGAAGCTTTTTCAAT
CAGGACATTTTCAAGGATATACCCGGTGTCTTGGACGACCTTGTCGAGGAAGAGGAAGGCGAAGACGAAGACGAAGACGA
AGAAGAGGAGGAGGAGGGTGAGATAGAGGATGAAGAGATGCCAGACGTCGATGAAAACGATGCCGAAGAGGACGACATTC
CCAGCAAGGGCAAGTCCGGAAAGAAGGGAGCTAAAGAAGAGGTAACTTTTGACGAATCAGAGAGCGAGGATGGCGGTGGT
GGTGGTTTCGAGGTCGTGAAGCGCAGCAAACAGGACACGGACGAGAACGACTGGGAAGAAGAAGACAAGCGACTCCGCTC
TGACGGGCGACTAGGTATGTCGGGCCTCTGTATGACGTCCATGGCGGATTTGGCGCAACAAGCTAACAGGTGTACAGACA
TTGATATCATCACGGCCGAAGCTATGACACTTGCACAATCCTTGGCTTCGGGACAGAGGCTGAAACACGATGTCATTGAC
GATGGATTTAACAAGCATGCCTTCCGAGACAAGGACGGACTGCCGGAGTGGTTCCTGGATGACGAGTCCAGACACGACAA
GCTTCACCGGCCGATCACCAAGGCAGGGGCGGACGCTATCAAGGAGAAGATGAGGGCTTTCAATGCACGGCCAATCAAGA
AGGTGCGGGAGGCGCAGGCGCGCAAGAAGTTCAAGGCGGTACAGAAGCTGGAGAAGCTCAAGAAGAAGTCGGAGCTGCTG
ATTGCGGACGAGGGTATGACAGAGAAGGAGAAGGGCGACACGATCAGCAAGATGCTCAGCAAGGCGGCCAAGAAGAAGCC
GCACACCCCGATGAAGGTGGTGGTGGCGAGGGGTTCAAACCGGGGTATCAAGGGACGGTATGTTATTCTCTCTCTCACTC
CCCCTTCCATGTCGTCTTTTCTCGGTCCCGGATGCACGTCTAACCGTGCACAGACCGAAGGGTGTCAAGGGCAGATACAA
GCTGGTGGATGCGAGAATGAAGAAGGAGACCAGAGCGCTGAAGCGGGTGGCCAAGAAGTACAAGAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62