GenePrediction:GLEAN_7790 Details

Name: GLEAN_7790
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:3007078..3003416 (- strand)
Length: 3663
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:3007078..3007047 (- strand)
Length: 32
Type: CDS
Source: GLEAN
Position: GCSC_113:3006953..3003416 (- strand)
Length: 3538
>GLEAN_7790 class=GenePrediction position=GCSC_113:3007078..3003416 (- strand)
ATGCTCTGGTATCTCTTGTACCCGTTCCGAGGGTAAGATTGTCCTCTTTCCACAGATCTGCAATCCTGCCTGCTTCTCTC
TTCCTGTTTCAGGCCTGTACGCTGCTGTTGATTGACATCTCTCAGGACTACCAATGCGCCTAGACTGGCTCCTGGCCACC
CCCTTCGAAAAAGCCTCACGCATTATGGGGTTTACATTGCACGAAACGTCGCCACCACTCTTCTCCTCTCTGTCGCCGTT
ACTATCGCTCTCCTCTACCCCGTCCCCTTTCTTTACACCAGCGACTTTACTAGCAGTACCTCCCATATTCCTCGCCATGT
CTGGACCAACGCAACCCCGCTCAAGAACGGCATCGATGTCGAGCCTCACATTGTCATGCGTTCCATATGGGTCCATGGAA
GCTACATGCAAGCCCTCAACCGTGATGTTCTCCTGAGTACTCTCGAACTACAGGACGAGCTCCTGGGACCTACTAAGAAC
TTCAATCCTCACCGTTCTAATGCACTAGACAGCCTCGAGATCGGCGACCCACTGGAAGATCTCTCTCCAGAGCAGCGAGA
CGCCTTTCACGTCGTCAATGGGCTCACAAACCAGTCTTGGTTCTTCCACTCGCCCTTGCTCTATTGGTCCGACGACCGCG
AGGCCATTGCCTCTGATTCTGACATTTTGGCCACCGTCAATGAGCACCAGAAACAGGCCACGTCCATCAACGTCACGCTG
CGCCACTCCCTCACATTCAGCGGAGAGCGCTTCGAAGACCGGGCTCTGGTCGCCGCCGACGCCCTCGTCATCACTCTGGT
CCATCTTCGCGACTCTCCCGTAGGCCGCCAGTGGGAACGGAAGTCGGCGGGGCTTGCCTCTCGCCTGGATAGCAGATGGA
CTGTTTACCCCAAAGAGGTCGGCCACAGTTTGCAGAGCCAGCTTTATGAGTTTCAGTTTCTTCCCATGTCCCTGCAGGAC
TCCCTGATGTTAGCCCTGGCGTATACCATAACCTTTGTTTACGTTATCCAGAACCTATCCAAGCTGCCGGCCATTAAATC
GCGCCCCGGCCTGATCCTGACTGTCGTCGCCCAGATCTTCATGTCCATCATGTCAAGCTTCACCGTTTGCGCCATCCTTA
GCGTGGATCTCTCGCGCATTCCCCGAGCCGCATACCCGATCGTCATCGTCTCCATGAGCCTCGAAAACATACTGCGGTTG
ATCAAGGCCGTCATCCTGACGAACAGCGAAAGCAGTACAAGCAGCCGCGTTGGTGAGGCGTATGGGAAGACGGCGCACAT
TGCCCTCGCCAGTGTGGTGGAGCATCTCGTGCTCCTCTGGATCATTTCCAAACTTGTTGCTTCCGGACTGTCGGGTTTCT
GCGGCTTTCTCGCCATTGCTATCGTCTTCGACTTCATATACCTCTCCACCTTCTTTTTATCTGTTCTCAGCATTGAGGTC
AGGCGCACCGAACTCGGCGAAGCAATCGAGAAGACTGCCTCTATGCGGCGCCGCCTCCACTCGACGTCATCCCAGCCGCC
ATCACCAACAGCACTCGGCCTGCCACGTCCATCCTGGTTTGCCGCTTTCCTGCAAGGTCGTGTCGACGTGTCTACGCGCA
TCGCTGGCACCGTCATCTTGGTGTGCTTTGTCGTGATCGCTCAGTGGCACTTCTTCGACTTCGAGAGCATGGTTCGCGCC
GTAGTTCGACTCTTCAGAGTGGCCGCTCCGGATACAGGTGGAGGCCACAACACAAATTACTGGGACAGCGTGTCGCCACA
GTTCAAAGAAGTGCACCAAGCGCGCAGCCCGGCCTCGTGGCTCCGTCTCCAAGACCAGACAGCGCGCGAAATGAACAATG
CGATACGACCATACGCATACAGCTGCGTTGCTCGTGTCTACGAGCCGCTTGTCTTTGTGCTGAATGGTGCTGACCGTATG
CCCAGTGTATCTGAGCGTCCATTTCTTCCAGCTGTGTACGACTTTGTCCGTCATCAGTGGAAGTCTTTTCTGGTGGCTAT
TCTTGCTGTACCCGCCGCCGTGCGCACATTTGTCAGCTATCTCCTATGGATTGAGGCTGATGAGGCAGACGACCACGTCG
AGTCAGCTGATGAGCCTCGTCTCTCGGTCAAGTCGCTCGATCAAGGCCATGCCTTGGATGTCGCCCTGTTGGTGGCATCA
CCCGACGGCCTGGTGGTCTCGGTCGGACTTGACCGACGAATCCGTGTTTGGAATGTGCAGTTCGGTTGCAGGAACTACCT
GCTCACCGAAGAAGACGACTCCACGGACGTGCCGTTTCCGGTACTAGCTTTGGCCATCGACGATGACTCCACCTGGCTGG
CTATCCTATCCACGTACATGGTCATGCTCTGGAATCTGGAGACCAAGCGGTGGGGTGCCACTCTTCCTGTTGACCTGTGC
GGACAGAAGCCAGAGGCCTTCTTCTTCACACCCGCTCTGAAGTGCACCAAGGTCCCCTCACTTGTGGTGGTGCGGCGAAA
CGGCACATTTGCAGAGCTCTGGGCGGATTCTTGCGAGATGGTGGACCATCCGATCTGCCAAACCCCGCTGGTTTGCGCCG
CGCCGCTTCACTGCCGAGCTCCGACAATACCCCCAGTGTCGGTCGAAGATCATTTTGCCATAATCGCAGCTTCGCGCAAC
GGTTGTGTGTACCGGATGTTCCGGGCCGGTGATGAGTGGATTTCAGAAGGACCAAAGCAGCAGGCGAATAGAGAAAGAAG
CGTCCACTCAGTGGTGGCGCTCGCGCAATTCCCTGCGTATCTTGTTGTGCGGACGTGGTCTGTGGACCTCGTCGATCTGC
GCACATCCAACATCATCCACACATTCCGGACCACCACGGCCATCAAGGCACGATCGCTAAGATATCTGTGTTCGAAGAGA
AGACAGCTGCAGATCGGCCCGCCAGAGCTGTCCCACTTCAGTCTCGTCTACTCGAGTGCCAGGACAGGACACTGCCTCAT
ACAGACATATCTGCCGGAGCAGGAAGGTGGATCGATTGCCTTGTTCTCCAACGATGGCCTCACGGGCATACCTGCCAGCT
CAGATAGCTCTTGCTGCACGTGGGATAGATCACGGCAGGTAACCAGAGACATTCCCAACCCGGGCAAGTGGGAAGCCCTG
CCTAACGGATGCATCGTCGGTGTACGGCGCCAGGGGCAAGCCATCCCCGACGGCTGCACGGGTAGCCTTAGCCATACTGC
CAGCGGCCATGAGTCTGCGGGCAGGACAGACGGCAGCCTTCGGCGCCGCGGGCTGGGAGCCCTGGCCGGAACAGTGCCTG
CAACGCCGACCACAGCGGCGAGCACAACCAAGACATCGACGGCTGCAACGGTGCCGGCAAGTGGCCCCGACTGTTGGGAG
GCCTGGTCGATGTGGAGCATGCTGGACAATCGAGACGGCGACAGCGCTGGCAGCCGGGGCTACGTGACACAGCCGCTGGG
AGGAGACCACGACGACCTGCTTGTGACAGAGCCGGGCCCGATTGTGCAAGTTGGGGCGGGAACAGTGGCTCTGGGCATTG
GAACTTCGATCAAGATCATCACTCTGGGCCACGAGCGGTTCGGCAGTGCGGCAGACTTGCTCCGCGCAGAACCAGAGGTC
ATGCGGGCAGGCAACGCGAGCGGACGGCGACGCAAAAACCGGCCGCTTCCAAAGGGAGCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62