GenePrediction:GLEAN_7792 Details

Name: GLEAN_7792
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2994641..2994325 (- strand)
Length: 317
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2994641..2994593 (- strand)
Length: 49
Type: CDS
Source: GLEAN
Position: GCSC_113:2994542..2994470 (- strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_113:2994418..2994325 (- strand)
Length: 94
>GLEAN_7792 class=GenePrediction position=GCSC_113:2994641..2994325 (- strand)
ATGGATACTCTCAAGCAAGCTGGCAACTTTGTCTCTGACAAGGTCAACAGTACGTCAACCATACAACAGCTCACTGAGAC
TGCACTAACAGTTACATAGGTGCCACCGCTGGCACTGCTAAGGAGGCCAACAAGAATGTGGCTAGCGACAGCAACCAATC
GATCGGTACCCGGTACGTCAAGACTTTTGACGAATGTAAGGATACATACTAACAATTTATCAGTGCCCAAGCCGGTGTTG
ATGCCGTGAAGAACAAGGCCACTGAGACCAAGCACGACACCAGTGCCGAGGCCAATAAGCAGGCTGCTACGCACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62