GenePrediction:GLEAN_7794 Details

Name: GLEAN_7794
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2990493..2988123 (- strand)
Length: 2371
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2990493..2989974 (- strand)
Length: 520
Type: CDS
Source: GLEAN
Position: GCSC_113:2989912..2989536 (- strand)
Length: 377
Type: CDS
Source: GLEAN
Position: GCSC_113:2989469..2988123 (- strand)
Length: 1347
>GLEAN_7794 class=GenePrediction position=GCSC_113:2990493..2988123 (- strand)
ATGGCTGGCCAGGGGATAGGCGCCGCGGCCACATGGCTAATGACGCGGGCAGCTCAATCCTCATCGACGATCTTTAACGA
GTCAACGATCCCTGACTATTCGGTTTATGAGGCGGCATCATCAAATACAACGTCGACACAGATGCTCATCAACGAACTCA
AGTTTGCTGTTGCCAAGTCTGTCCGCACATCTACTATCATCTTGGCAACCTTCAACGCCATCGCGGCGTTTGCGACGGCT
TGTGGTATTCTCTACGATGCATACGCAACACGGAGGAGGAACTGGCAGCACTACAGGACGAGGTACGACAAAGTCCTAGA
GGATGAAGGACGACAGGACCGAAATGCTAATACTAGGCGCAGTACTCGTCCGTGTCTTCTACAAGCTGCAGATACCTACC
CGCTGATCTTGTCTCTTGGCATCACAATCCAGGCGATTGCCTTTGCCGTTGCCCAAGCGCAAGGCCTCACGGGCATACTA
AAGCTGGGCTGTGCTATCATTTCTCAATTTGTGTTTCCAGGTATGTCCGTATCAGCCAAGTCGTCTCGCTAGAACCAGCT
CTCACACAGACACCTATCTAGCGTTATTTCTTGTTCCTTATATACAGCTTGTGTTTTCGCTCGAGATTTCGATTCGGGGA
CTGCGAAAGAAGCCGTTCCCTTCGCGAGGCAAATTCACGGTCACCATCTGCCTCGTCATCGTGTGCATGCTGGTGCTCAT
GAACTTTCTTGTTGCAGACTTGGACCGGGCGCCTGATTTCTGCTTTGCCTCTCTCTTCTGGTTTATCGCCGTCTACTCGA
AGGGAATCTTTGCGGCGTTGCTGGCTATCGACGTCATTCTGGTCATTTGTTTGATCATTCTCTCTGTGCGGCTCACCCAA
AGCGCCGAGATCGAGACTTCGGAGCGGGTTGCAGCCTCGCGTATGGTCTACTACCTGGCGCTGGCCATTCTGTCGAATGT
GAGTGCAGGCTTGGCTCTACGGCCTAGGTTGCTTGTTTTGATGTCCACGGAACTGACCTTGTAGACTCTCCTCCTTCCCT
TCTTCTTCTCGCTGGGTTTTGTCAAGCACAGCACATCAGGGAACCAGGCGATAAACTGGTCCATGGTTGCATCGGTGGTG
GCCAACCTGTCCGGCTTGACGACTGGTGGCCTTTACCTGTTCATGCGATCGGCCATCATCTCGACCATCGGGCCTCGCGA
CAAGGCCAGCGAGTACGACCGGCAGTGGATGAAAGACCAGATCCGGCGATACAATGCGAGCGACCCCGACTTTGCAGGCC
ACATGATGGGGCCGGTCAACAGCGCTGTTGATCTACGCCATATTCTGGACGATGCCAGTCCGATTGGCGGCAGCCGCGAC
GACAACGACGAAGAGCGCGGCATGCGAACAAGCCGAAAATGGCTGGCATATAGCGACTCAGCTTCACGGCCGGATCCTCT
GCGGTCGAACGCGTTCATCCCGTCGCGTCTCACGACGACTCCGGCAACGGCAACATTGGCAGCAGTGGCAGCAGCGGCTG
CGGGAGCGACCGTCCGTGTCCCAGAGCCGGCGAAGATGCCGGCTGCAGAGGCGGAGACACGCCCATCTCACTCGTCATTG
ACGCTGTGGTTAACGGCAGCACTGCCGACGGCGTCGAACATGAGAGCATCCGTCGTGTCCGACACAAAATCGCTCTTGCT
GCTGCCGGCGACAACGTACTCGCCAGGGGTGGCCAAGTCGACGAAAGCCGACAACAACAGCCGGTCTGGATCGAGCGCAT
TGAAGCCGCCGCCTTCGATGAACAGCCTCCTTTCCGGGCGGCACCGCCGTGATTCATCCATGGTATCGATGACGACAGTG
CAGATCGGCCTGCGGCTGTCCAACATGGCAGATGTTTGTCTGGCGCCGACGGACTCGCAGATACTCGACAAGAAGGTGTA
CACGCTCGACGATGCCAGCATTGACTGCCAGCCCCCGGCAAGGCCAACTGGGGCAGACGAGAAGCAGTCGGGGATGATAC
CGATTGCGACGGATCTGCCGACGCAGCGAACCCTGCCCGTTCGGCAGCGGAGTCCTCTGGCAAGAACGGAGCCTGTCAAG
GATGCGCAGATAAAGGCACTGCCACCGGTGCCGCTGCTCGTTCTGACAGGAGGGCAGCAAGAGCTGTGCATGGACGAGTG
CAGCGAGGACGAAGCGGATGCCAGTGAAGTGGTTCTCAGCGCGGCAACGTATAGGCCTGAGAGCCCGACCAAGGCGAAGC
TGGCCAGTCCTCGAGGGGTTGGCATGACTGCGCTGCCGTCGCGGAACAACAGCACCAAAGCACGAACAGAAGCCATGATG
AGCTTGACGGGCCAGTCTTCGAAAGACAAGACTGCTGGCGACTGGATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62