GenePrediction:GLEAN_7796 Details

Name: GLEAN_7796
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2954832..2953233 (- strand)
Length: 1600
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2954832..2954460 (- strand)
Length: 373
Type: CDS
Source: GLEAN
Position: GCSC_113:2954407..2953233 (- strand)
Length: 1175
>GLEAN_7796 class=GenePrediction position=GCSC_113:2954832..2953233 (- strand)
ATGAAGGCAGCTTCGTTCTGGATGTCCGTTCTTGCCGGTGCCGCAAGCCTGGTGTCGGTGCTGGGCAAAGATGTGCAGAC
GCAAGCAGAAAAGATATTCCGGAAGCTCCCCGGTATTCCAGCGAAGGAGGCGGAAACGGCGGACGGTCAAATCGAGGGCA
CGTTCCAACAACTGCTGGACCACAGCGACGCCAGCAAGGGCACTTTCACACAGCGGTTTTGGCTTGACACGCACTTCTGG
GACGGCCCAGGCTCGCCCGTGTTTTTGTTCATGGCAGGGGAAGAAGATGCGTCTGGGTATCTGGGCTACCTGCGAGAAGG
CATCCCGGGTCTCTATGCGGAGAACTTTGGCGGCTTGGTGGTCGTGATTGAGCGTGAGTTCTGCCTGCATCTGACGAAAG
GGCAGACGACTGAGCAGTGCTGCAGACCGCTATTTTGGCAAGTCACAGCCGTTCGACACCCTGACGGCCGAGACGCTGCG
GTTCCTCGACCTGCCCAACAGCATGAAGGACATGACGTACTTTGCTCAGAACGTGGACATCGAGGTGGCCAACGGTACGG
TTCTCGACAAGCCTTCGGAGGCGCCCTGGGTGCTGATCGGCGGCTCGTACTCGGGCGCCCTGGCGGCGTGGATCCAGCAG
AAGGAGCCGGGTGTGTTCTTTGCCTATCATGCCAGCTCGGCCGTGGTCGAAACGATCTCGGACTTCTCCTCGTACTTCAA
GCCGATTGAGGAGGGGCTGCCGCGCAACTGCAGTGCCGACGTGCGAGCTGTGGTGCAGTACATTGACAATACGCTGACAG
ATGGTGACTCAATCGCGGTCGAGGACCTGAAGGCGATGTTCGGGCTAGATTTCCTCGAGGCGGACGATTTTGCCTATTGG
GTGTCGCAGCCGATTCAATCCTGGCAGGACAACGAGACGGCCGTGTTTGCGTTCTGCGATCTGCTGGAGGCCACCGAAAA
CACGGGTCTGGATGAATCGGTCGACGGCCTTGGCCTAGATGTTGTCTTGCCGTTGTATGCCGATTACATCAACGGGACGT
ACGGCCTGTACTGCCGGGCCGACAACTATACCATCTGCGATTCGCACAACCCGTCTACCGATGCCTCGTACAACGATCCG
ACCGACTTCGGCTCGGACCGTCCATGGGAGTGGATGCTGTGCCACAATCCCTTTGGCTGGTGGCAGGTCGGCCCCAATGT
CACCGACGGCACCAACATTGTGTCACAGTACATCACCGTCGACTGGTACACGCGTCGGTGCGCGCTGTACTTTCCCGAGA
CCAATGGCTACCGCTCCGGCGCCGAGGACGGCTGGACGCCCGAGCACCTCGACTTGTACACGGGCGGCTGGGATGCCCCC
TTTGAGCGCGTCGTCTTTGTCAATGGCGAAGTCGACCCGTGGCGCGATGTCACCGTCTCGTCCGACTATCGGGATGGTGG
CCGTCGGCCAAGCACCGATGACATGCCCGTCTTCGTCGTGCCCGGCGGAAATCACTGCCCCGAGATGCTGCTGGAAGAGT
TCGATGGATTGCCGGATCTATACGACAATCTTGTGGCTATCATGGCCACCTGGCTTGGCGACTGGGAGGCTCCCTCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62