GenePrediction:GLEAN_779 Details

Name: GLEAN_779
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:2045489..2048081 (+ strand)
Length: 2593
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:2045489..2045586 (+ strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_97:2045661..2045798 (+ strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_97:2045876..2046650 (+ strand)
Length: 775
Type: CDS
Source: GLEAN
Position: GCSC_97:2046710..2046961 (+ strand)
Length: 252
Type: CDS
Source: GLEAN
Position: GCSC_97:2047026..2048081 (+ strand)
Length: 1056
>GLEAN_779 class=GenePrediction position=GCSC_97:2045489..2048081 (+ strand)
ATGGATGAATGCACCACTGATTCCCGGTCGGAAAAGCGACCGACCCCATCCGAAGACACTTCACGGGCGAAGCGGGGAAA
ATACACCTCGGCTGCATGGTAAGCCCACGAGCAAGAATACATACAGGCGATGGTAATGTAGCCTGGGCTAATGTGCCTCA
ACCCCGCTATAGTAATCTGTGCAAGAAAAGGAAGCTCAGATGTGTGCCGAGCCAAGACGGCGGCAGCTGTCAGCGGTGCG
CCGGGGCCGAACTTCTGTGCGTATTTGACGCACCGTCTCGGCAGGCCGGGCGAGAAAAGACTGAGAACAGGTACGTATCT
CGATCATGCCACCCGGCTATTGGGCTGTATCTCTGCTTTGCTAACAGAGTCTCACCACCTCCGCTAGCAACAACGACCAA
CTGAGACTTCTGCTGAGCGAGCTGGCGGGGCTGCGACGCCAGGTCGGTGATTTGGCAGGGGCAGTGCACGAATTGCAACA
GAGCGTCTACAGCGGCAGCAATGACGTCGTCAAGAACGTGTCATCGCCATCTCATGGCAGGGCGTTTGCCGACTCGCCAA
ACACGCAAGCACCAGGGTTGCGCCGGAAGCCAAAGTTTATGGGGCCGACGAGGCCCGACTTCGACTTCCAGGTTGGCGAA
CGGGCCCTTCATCGCATGGGCATCCCCCTTGTCAGTAGCGATAGTGACGGAGAGGCGGTAGCACACAGTTGCAGCCAGTC
ACCGGTGCCCTCAACACCCACAGAGACAGCGACTGCAGCTGCAGCTGCAACGGCAGAGGCCAGCGCCGGTGGCAGCTTCC
ATCCCCATCTTCGCTGGACTACCGACGAGATTGTGCGGCTGCTCGGCGTGTACGACGAAGACGTAAACTCAGTGTTCCCA
TGCATCGACGTGGCCGACCTGGCTGCACAGCCGCAGGCAATCCGCGACGACGTCCTGCGCTGTCTGCGTCAGCAGGAGAG
CGTTTTGCTGCCCGATACACGTGCATCTGCAGGCGCCGGCGATGCTGCCTTGGCCCGTGTTGTCATCGCCACGGCCGTCG
TTCTCGAGGCCCGCGGCCGCAATACCGTCAGCGAGATGCTCGTGAGCCCCGTCGAGCGGAATGTGTCGTGCATCGCCAGC
CCCGAACCAGACATGAAGGAAGTGCAGCTGCTGGCCGTTTTGGTATGACCGTCCACTTCTCTATATGGTCTGATTCTGTA
TCCTTGGCTGACCTTGCGCAGAGCATATACTACTTCCACATTGACCAGGACCTTCTCGCATGGAGAGCCATCAGCGTAGC
TGCCCACGAAATGCTGGAGATGGGTCTGCACAGGAAGCAGAGCCTACTGGAAAACTATAAGTCGTCCAACGCCCGCCAGC
TGGCTACACGTGTCTTCTGGTGCGTCTACGTACTCGACCGCCGCTGGAGCATTGGCATCAGTTTGCCCTTCGCGCTCCGC
GATCGCGACCTCGATCCAGAGCTTCCAGAGCCGGTACGTTAGTTCACTGCTTACTAATACAGTATGTGCATGCTTACATC
CCCCTCTGCCTCTGCAGGGCCTCGACTTGCCATACCTTCAATCCATGGTAGGCTACGGCCGGCTATGCTCGCAGCTGTGG
GATGCCATTCCGGTGCTGCATAGTACTGGCGGCGCTGGAGGTTTAGGCCCGCGGCAGCTGCTGCAGGATGACCAGGTGGC
CTTGTTGGACCTGCGCGTGCAGGAGTGGCTGGCCCAAATTCCAGCGGAGCTGCAACTGCGGCATCCGCGGCTAGGCCTGG
CGCCACGTGTCCAGCCACACGTGCTTCATCGCCTGCGTACGCTGCTATACCTCAGGGCAAACAGCCTTCGCATCCTGCTG
CATCGCCACCGTCTGCGCAGCCCAACGGCCATTGAGGCTGATCCGCATGGCGCCTGGCTGGTCGTCGACATCGCCATGGA
CAGTATCCAGGTGCTGTTTCACCTGAATGAGACGACTGACATCTATGCTCGGCAGCAGCGCGCTTTCAATTACTTCTTGC
TTAGTGCTCTGGCCGTTCTCTTTCTGGCCGTGTGTCACGCGCCGCGCATCTTCACAGAGCCCTGTCGCCGCAGCTTTGGC
GATGCCGTCGCGCTCATTCGCTGCTTCTCACACGACAGGACTGTTAGCCGCCGGCTCTGGCGTAGTATCCGCGGACTGCT
GCCAGCCTTGCGGCGTCTTGGCCTGCACGAGGACGGCCAGAAGGCGGTGATGGCCACATCAGCGTCGAGAGCACCCTCGG
CGGCGACATCTGTGGCAACGGCAGCAACGGAAGGCACAGAGGCGGTGGCGCCTGTCCAATATGTCGAGGCACATAACACT
TCAACGGCTGTCATCGCTGGCGACGCTGCTGGTCGCCTTCAAATGTGGAATGCTGCTGACCCATACATGCAGATGGGCGA
CTCGCTGTACGATGACACCTTCGGTGGGCCAGTCCCCGACATGTTTCAAGTCGACACAGATCTCCTCACGCTCTTTGATA
TATTCGGGCAAGGACAGCAGTTGGATGAGGGGCTGCATGCAGACGTCTTCGCGGACGGGCCGCTCGTCGGAGAAGGAGGC
GGCATCTCGCAGCGATTCCAGTGGCTGATTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62