GenePrediction:GLEAN_77 Details

Name: GLEAN_77
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:502095..503122 (+ strand)
Length: 1028
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:502095..502227 (+ strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_179:502290..503122 (+ strand)
Length: 833
>GLEAN_77 class=GenePrediction position=GCSC_179:502095..503122 (+ strand)
ATGACCGCCGGCGGCGAGCAGCATGCCGCGGGCGTCTCTCCGGCTCTCATCGAGGCCATTGCCGGCCTGACGGCCGGTTC
CATAGCCACGCTGGCAGTCCACCCGCTGGACATTGTCAAGACGCGGATGCAGAGTGTGTTTCTGGTGGAAGCCAGGGCTT
GCTTACGAGCGAATGCTGACACTCCACCATTCTAGTCTTCCGCGGGACGGCCACGGCTTCGGCTTCCGGCACCTGCATCG
GCGGTCCGGCCGCTCTGTCGGCGGCTTCAGTCCTACGCGGCCTGCTGGCAGCGCCGCATCCGCTGGCGGCGCTGTACCGC
GGCCTGACGCCCAATCTGTTGGGTAACGGCACCAGCTGGGCCTCGTTCTTCTTTGTCAAGTCGCGCATGGAGCGTCTGGT
GGCCTCGGCCAAGGCACCCGGACCCCAGGACCTGACACCGGCCGACTACTTTGTCGCGTCCGGTCTGGCCGGCATCTGCG
TGCAGGTCATCACAAACCCGTTGTGGGTTCTCAAGACGCGCATGCTGTCGTCGGACCGCGGCGCCCAGGGCGCCTACCCG
AGCATGTGGGCGGGCGCCATCCGCGTCCTGCGCGAGGAGGGTCCCCGGGGCTTCTACCGGGGCCTCGGCGTCAGCCTGAT
TGGCGTCAGCCACGGCGCCGTGCAGTTTGCTGTGTACGAGCCGATGAAGCGACTGTACCTTCGGAGGGGCTCAGAGGCCG
ACATCGACGCCTCCCAGAAACGCCTCCGGAATCATGCCACCTTGGTCATCTCCACCACGGCCAAGCTCGTGGCCGGCGCC
GTCACCTACCCGTACCAGGTCGTGCGCAGCCGGCTGCAGAATTACGACGCTGAGGCCCGCTTTGGCCGCGGTATCGTCGG
CGTGTCGGCACAGCTGTGGCGCGAGGACGGCCTGCGCGGATTCTATCGTGGCCTCGTGCCGAGCGTCATCCGCGTGCTGC
CCGCCACCTGGGTGACCTTTTTGGTGTACGAAAACATCCGGCACTCCCTTCCCCAGTGGATTGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62