GenePrediction:GLEAN_7801 Details

Name: GLEAN_7801
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2930637..2929337 (- strand)
Length: 1301
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2930637..2930625 (- strand)
Length: 13
Type: CDS
Source: GLEAN
Position: GCSC_113:2930559..2930298 (- strand)
Length: 262
Type: CDS
Source: GLEAN
Position: GCSC_113:2930210..2929337 (- strand)
Length: 874
>GLEAN_7801 class=GenePrediction position=GCSC_113:2930637..2929337 (- strand)
ATGGCCTCTCCACGTACGTCATCCCAAGGCTGCCGCCTTCCGTTTCTGCCAATGCTGACCTGACCGACCATCTTGTAGAG
AAGATTCGTACGCCGATCACCGATCTTTTCAAGATCAACCACCCCGTGCTGCTGGCCGGCATGAACGTCGCCGCCGGCCC
TCTGCTGGCTGCTGCCGTCACCAATGCCGGCGGCCTCGGCGTCATCGGCGGCGTCAACTACACGCCCGAGATGCTGCGCG
ACCAGATCGACGAGCTGAAGGAGCACCTGACCGACAAGAACGCTCCCTTTGGCGTCGACCTGTTGCTGCCGCAGGTTGGC
GGTAATGCTCGCAAGACCAAGTATGTCTTTTTTTTTTTTTTTTTTCTCGCTACGCTCGATTCCTCTGTTGGCACAACTTC
CTCAACCACATGATGCTAACATCCCAGCTACGACTACACCAAGGGCAAGCTTGACGCGCTCGTCGATATCGTCATTGAGT
CCGGTGCCAAGCTCTTCGTCTCTGCCGTCGGCGTCCCACCGCGTCACATCGTCGACCGTCTGCACAAGCACGGCATCCTC
TACATGAACATGATCGGCCACCCGAAGCATGTGCCCAAGTGTCTCGAACTCGGCGTCGACATCATCTGCGCCCAGGGCGG
CGAGGGTGGCGGCCACACCGGCGACATCCCCACCACCATTCTCATCCCCGAAGTCGTCCGCCGCGTCCAGGGCCACAAGT
CTCCTCTCACCGGCGGTCCGGTCCTCGTCGTCGCCGCCGGTGGCATCTACAACGGCCCACTGCTCGCCGCCTCACTCATG
ATGGGTGCTGCCGCCGTCTGGGTCGGCACTCGCTTCATCCTGACCGACGAGGCTGGCGCGCCCGAGTCCCACAAGGAGGC
CGTTCGCACCGCCGGTTTCGACGACACCATCCGCACCCTCATCTTCACCGGTCGGCCGCTGCGCGTCCGCAAGAACCCCT
ACATCGAGCATTGGGAGACCGAGCGTCAGGACGAGATCAAGCAGCTGACCGCCAAGGGAAAGCTGCCCTACGAAGCCGAC
CTTGACAAGGTCATGAACGGCGAGATCGACACTCTACCCACCGACCTCGCCGCCCCCTCGGCCAAGGCTGAGAAGAAGGA
TGGCGCCGACGAGGAAGAGCTCGACGTCGACGACCTTATGGACCAGTTCCGCCCCTTCCTCATGGGCCAGTGCGCCGCCG
TCGTCAACGAGAAGATGTCGGCCAAGGCCGTCGTCGACGAGTTTGTCAACGACGCTTCCGTCTGCCTCGCACAAGGCTCC
AAATTGGTAGCAAAGCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62