GenePrediction:GLEAN_7802 Details

Name: GLEAN_7802
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2926594..2925684 (- strand)
Length: 911
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2926594..2926244 (- strand)
Length: 351
Type: CDS
Source: GLEAN
Position: GCSC_113:2926183..2925999 (- strand)
Length: 185
Type: CDS
Source: GLEAN
Position: GCSC_113:2925927..2925684 (- strand)
Length: 244
>GLEAN_7802 class=GenePrediction position=GCSC_113:2926594..2925684 (- strand)
ATGACGCCTCCAACAGTCTGTTTCTTTGCCGCACATGCTGCTGCCACAGCGGCCAGACGAAGCTGTCGCACTGTCTACTT
CCCCGCCTCGACCTCGTCCCGTTCTCCCGCCCGCCTTTGCCCCCTGGCCTCCCCCTGGCTGGTCCGGGGCTATGCGACGC
AGCATCAAGGGACATCTTCCTCCTCGTCCGCATCATCCAAGGCTTCATCGGCCGCCCGGCGCAGGGCTGTCACGCCTTTC
AACGACGATGGCCGCGTACCCTGGTCTGATCTGTCGATGGGGGAAAAGACGGGTCGTGCTGCACAGCAGACAGTCAACTT
TGGACTGGTCATTGTTGGTGTTGTCTTGACGGTATGCATCTCTCCATCGAGTCCGTCTGCCACCCCCACACAGCTGCTAA
TCTCCTTTCAGAGTGGTGTCGTCTACTTTCTCTACACCGAGGTGTTCTCGCCTGACAGCAAGGTCTCCACATTCAACCGG
GCAGTAACCCGCATCCGCTCCGACCACCGATGTACCGTAGTTCTCGGCGACGGCGAGACCATTGCTGCATATGGTCAGCA
GACATGGAACAAATGGCAGCGGGCGCGTCCGATCGCGTAAGTCCTCCTCCCACCAACTGACGCCACGCCCAACTTTGCGT
GTCCTGACACCGCTCTTTCTCTCGTAGGTCTACCATGCAAGCAGATTCACAGGGAACGGAGCACATTGTCATGAATTTCA
ATGTGGAAGGCTCGCGGACCAAGGGCGTGGCCTATCTCCACATGGTGAAACCACGTGGGCGGGATGAGTTCGTATATCGC
TACTTCTATGTCGATGTCCCAGGACATGACAGGATCTACCTTGAGAGCTCCCAGGGGCATGAACATACAGGAGACGGCAA
AACGACTCTATTTGGCATAAAGTGGTCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62