GenePrediction:GLEAN_7804 Details

Name: GLEAN_7804
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2918490..2916860 (- strand)
Length: 1631
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2918490..2918322 (- strand)
Length: 169
Type: CDS
Source: GLEAN
Position: GCSC_113:2918270..2917547 (- strand)
Length: 724
Type: CDS
Source: GLEAN
Position: GCSC_113:2917487..2916860 (- strand)
Length: 628
>GLEAN_7804 class=GenePrediction position=GCSC_113:2918490..2916860 (- strand)
ATGGGACAGATCGACGAGGCAGAGCCCCGGGCTGTGGATGTCCGGGACGAGGACAAAGATGAAGCGCTGGCTATAGTGGG
CGAGTCTGCACACGAGCTGGACGCGGCCGTGGTGGCGCGGGTAGTGCGCAAGATGGATCTGTTCTTCATCCCGGCCATGT
TTGTCGGCTGTGCGTGTTTCCCTTTCTGTCTTTCTCTTCTTTCCGCTAACCAAGTGCAAGACGGCATCGTCTACTACGAC
AAAGCTATCCTCGGCTCGGCCGCGCTCTTCGGCATGACCGGTGACCTGCAGCTCTCCATAACCAGCACGGCCACGCGGCC
GGCCACAACGGACACGTCGCGGCTCAGCTGGGCCACCTCGCTCTTCTACTTTGGCATGCTGGCTGGCGTGTACCCGATGA
GCTTCGCGCTGCAGCGTTTCCCCGTCGGCCGCGTACTCGGCCCCGTCGTCGTCGCCTGGGCTGCCGTCTGCATGCTGACC
GCGGCCGTGTCATCCTGGCGCGGCCTCTACGTCCAGCGTTTCTTCCTCGGCTTCGTCGAGAGCGCCATTCCCACCGCTCT
CATGGGCCTCGTCGCCGCCTTTTACACTCAGCAGGAACAGGCTCTCCGCCAGAGCTGGTGGTTCAGCAGCACCGGCGCCT
TCACCATCGCCGGCGGCGCCCTCAACTATGCCTTCGCCCATGTCGTCGGCGGCCGCCTGCACCCTTGGCAGTACATCTAT
CTGCTCGCCGGCTGCCTCACCCTCGCTCTCGGCCTCCTCTGCTTCGCAGCTCCCAACTCGCCCGCCACCGCCTGGTTCCT
CGCCCCGTCCGAGCGCTTCGCCGCTGTCGAGCGCCTCCGCCACGGTCAGACCGGTATGCGCTGCGTCCATTTCAAGCCCG
CCCAGCTGCGCGAGGCCCTGCTCGACCCCAAGGTCTGGCTCGTCGCCATCATGATGGCATCTGCGTATGTGTGGCTGTGC
TTGTGGCTGTGCACATATCCTACTTCCTGCTGACTAATCAAAGCTACACCATCAACGGTGCCGTCAGTGGCTTCGGCCCT
CTCATCGTCTCGACCTTTGGCTGGTCCAGGCTCGACTCTATCCTCTTCCAGTTCCCTCTCGGCGGCCTTTGTTTCCTGTC
CATTCTGGCCACCGGCTACGTCGGCAGCCGCGTGCCCCACACCCTCATCCCCATGCTCATCGTGTGCTGCCTCCCCGTCA
TCGCTGGCTGCACCCTCATCTGGCGTGCTGCCTGGACCCATCGTGCTGCCGCTCCCGTCGTCGGCTACACCATCACAGGA
ACCTTTGGCGCCGTCGTCAGTCTCGTCATCACCATCGGCATGTCCAACGTCGCCGGCCACACCAAGAAGAGCTTCATGGC
TGCTTCCATCTTCGTCGCCTACTGTGTCGGCAACATCATCGGCCCCCAGCTCATCCGCACCCAGACGAAGATGAGCCACT
ACCCCGAGCTGTGGACCGGCCTCATAATCTGCTATTGCATATGCATCGCCGCCGCCGCCGCCCTCTACGTCGTGCTCTGG
CGTGAAAACCGTCGCCGTGACGCCCGGCCAGTCGACGAGATGGAGCGCGCCAAGCTGGCCTTCCAGGACCTCACCGACAG
GGAGAACCCTTACTTCCGCTATAGGCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62