GenePrediction:GLEAN_7805 Details

Name: GLEAN_7805
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2904426..2902969 (- strand)
Length: 1458
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2904426..2902969 (- strand)
Length: 1458
>GLEAN_7805 class=GenePrediction position=GCSC_113:2904426..2902969 (- strand)
ATGCAACGAGCTCAGTCTGCAGTGGATTTTTCCAATCTGCTCAACCCCGACTCGGCCGGCTCCGCTGGTGACTCCATGAT
CCGGCAACAGCTCCAACAGCAGGACGAGATGAGCGACATTGAAATGACATCGGCCGGAAGCACTTCCGGCCTGGCCACGT
CTATTCGCCCTAACGGCCCTGTGCCTACCGGCCAGCCGTCGGAGGCTTCGACTGAGATGCCTCGGCCGTACAAGTGCCCG
CTTTGCGACAAGGCCTTCCACCGTCTGGAGCACCAGACCAGACACATCCGCACGCACACGGGCGAGAAGCCGCACGCCTG
CCAGTTTCCCGGCTGCAGCAAACGCTTTTCCCGCTCGGACGAGCTGACCCGCCATTCTCGCATACACAACAACCCGAATT
CGCGCCGCCACAACAAGGTCACCCACATCTCCCACGGCTCCTACGGAAACCCAGAGAGCCTGATGCCGCCGCCGCCAGGC
CCCAAGACCATCCGCTCCGCTCCGCCTTCGGCCCTGGGCTCGCCCAACCACTCGCCGCCGCACTCCTTCTCCTCCTACAG
CCTGACCAGCGGTCTGAAGCCGCCTTATGGCAGCAACAGTGGCAGCCGTGGTGGCGTCACCTTTGGTAGCACTGCTCCCC
AGCAGGCCCACGAAGGCATGGACATCAACCTGCTCGCCAAGGCTGCCCACCAGGTGGAGCGCGAGACACTGATGGGTCCG
CCCTCACACTTCTCCTCGCCCTCTTCCTCGCGTCATCACAGCCACAGCAGCAGCAGCCACCACCTGCTGCACCACCACCA
CCACAACGGCAACCACCATCACACCAGCCCGCCCTCGTCGTACTACGCCCACTCGGCCCACTCTTCGCGCAGCCACCTGC
CGTCGCTCTCGGCCTACCACATGTCGCGCAGCAACTCGCACGAGGATGGCAACCATGGCCCCAACTCAGCCAGCACCTCG
AGCAGCAGCAACGGCGACGAGCACTACGCAAACAACTACCGCATGCCCAAGCGGTCGCGACCCAACTCGCCCAACTCCAC
GGCCCCGTCTTCGCCGACGTTCTCGCACGACTCACTCTCGCCCACGCCCGACCACACACCGCTGGCCACACCGGCGCACT
CACCGCGGCTACGGCCCTTTTCCAGCACGTACGAGCTGCCGCCGTTTCGCCAGCTGTCGCTGCAGTCGCATACTACGCCC
GCCTTGGCGCCACTCGAGCCACAGCCCGACTCGTCCAAGTACACGGCGCCCAGCTCGACCGTCACGCGGAGTAGTAGCGG
CATGTCTCTCAGCGACATCCTCAGCCGCACAGACGGCTCGCAGAGGAAGCTGCCGGTGCCACAGGTCATGACCAAGGTGG
TGCCAGATCTCCTCATGCCGAGCGACGGCTTCAACCTCAGCGGCCGGAGCTCCACAGCCAACAGCATCGCGGGCGGCGAC
TTGATGGAACGCATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62