GenePrediction:GLEAN_7806 Details

Name: GLEAN_7806
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2893720..2889729 (- strand)
Length: 3992
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2893720..2893702 (- strand)
Length: 19
Type: CDS
Source: GLEAN
Position: GCSC_113:2893609..2893565 (- strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_113:2893505..2891413 (- strand)
Length: 2093
Type: CDS
Source: GLEAN
Position: GCSC_113:2891309..2890863 (- strand)
Length: 447
Type: CDS
Source: GLEAN
Position: GCSC_113:2890801..2890502 (- strand)
Length: 300
Type: CDS
Source: GLEAN
Position: GCSC_113:2890427..2889965 (- strand)
Length: 463
Type: CDS
Source: GLEAN
Position: GCSC_113:2889898..2889729 (- strand)
Length: 170
>GLEAN_7806 class=GenePrediction position=GCSC_113:2893720..2889729 (- strand)
ATGGATCGCGCCAGAAAGCGTACATTCCGCCCACCCCGCCGTCTTCTTCGCGCTCGCAGAGCTTCGACCTCACATTCTCC
TGGCCCGCCTTGCTAACTATCTTTGTGATAGGCCACCTCCGGGCGCTGAACGAGCGCGCATGGGCAGGCGAGACAGGTGA
GCAGACCTCGCCGAGCTTCTGCTGCGTTCCCGCTCGCTCACCACCTTGTTTCTAGATCTCTTCGCCGTCAACAAGTCTCT
GGACTCGTCTCTGAAGAAGAACACTGCTTTTATCCGGCGCTTGCGAACGGCCATCTCCTCTGCGACCCTCAACTCCTTCC
TGCAAGAAATCGCTTCGCTCAGTCTCAGCAAGTACCTGTCCGAGATCATTTCCGCCTGCTATGAGGGCCTCTGTCGCCTC
AAAAACCCCTCCGACATCGAGGCCGGCGTCGAAATCGTCTCGGCTCTCCACCAGCGCTTTGGGCCCTCTGATTTCACCGA
ATATCTTGGATGGCTGCTGGGCAAGGGCATGGCCCAGCCGGACAAGAGCATGATCAAATCTCAGACCACCGAGGCACGTG
AGAAAGACGAAAAGGAGCGCATCACTCTCCAGCGCGTGCTCCTTCGCGTTGTCACTGAGTTGTGGCTCGCCGGCGTTTTG
CGCACGCTGGATGATGTCAACCGTCCCGACGATGCTACCAAGGGTGCTGCCGGAAAAACGGCAGACGTCAAGCTTCGAAA
CGGAGTTGCGAACAAAGCCGGCGCCGCCGATCCCTTTCCGCTGGCCGTCTTGAAAGACCTTCTCGGCCACGACCGCGAAC
ACGTTAACCTTCCTCTGCTTGTCACATTTGTCAAGGCCTTCAGCTGGGATGTACTCGGGGTCAAGGGCGCCGGCTCCGAG
AGCCGCAAAATCGGCGACGATGACAGCAGCGCAAAGACAAACGGGCAAACCGACAAGGAAAACGGCAAAGCGGAAACCGA
AGCCGCAGCCGCAGCTGATGGTGCCGATCAAGCTCAACAGCTGTCTGCTGTGCAAGGCCCACCGACCGACGAACAGTCGA
TCACCCCGCGAGAGTTGCAGGAAAAGTTTAAGAGCATCCTCAGCCGCTACTTTGACGATGTAAAGGGCCACTTGGTGCGC
GACCAGAAGGCTATCTCGAACCAGTCACGCCGCAATGCCGAGGCCTACGTCAAATCTGGTGAGGTTTTTGAGGACCGCCA
ATCAAACTTCGAAAAGCAAGTCAAAGCCCAGGAACGGCTTGTGGCCAATGCTCAGGTGATCGCTGACGTTATTGGCGCCG
AGATGCCCGAGCTCAAAGACGGAGAGGATGGTCCTTCTGCCACTGGTGGATCGATCGGCATTGTCAAGGCTGGGGACTAC
CTGCGTGACCAGGGCGAGGGGGCGGGCATCTGGGAAGATGAGGAGGAGCGCCGCTTTTACGAAAACCTGGTTGACTTAAA
GGGCAAGGTGCCAGCCATTCTCCTAGAGGATGTCAAGAAGAAAAAGACCGATACGGACGAGCAGGTGGGCAAGAAGGCCG
ACCCGAGTGAAGGGCCGGAACCCCCGAAGCCAGCGGACAGTGCTGGGACCACCGTCTCGACCGACGAGCTGTCCACTTCG
ATTGTGAACAAGAGTATCGGCGCCCAGGTCGATACGCTTCTTCTTCGACTGCCCGACTTGACAAACAAGGATGTCATCGA
CCAGACAGCCATTGATTTCTGCTTTTTGAACTCCAAGGCATCGCGAAACAGGCTCGTCAAGGCACTCACCGAAGTTCCCA
AAGGACGCAGTGATCTCTTGCCGTGCTGGGCTCGCCTGGTGGCGACTTTGGGACGATATATGCCCGACATTCCCAGGGGC
CTGGTGGAGCACCTCGACGCCGAGTTCCGCAGCCTCCAGCGCCGCAAGGAAAAAGACTTCCTCGGCCAGGTACGCCTCAG
CAACATCCGCTACTTGGCCGAGCTCACAAAGTTTGGCATTGTCCCCGAGCATGTCGTCTTCCACTGCCTCAAGATCAGCC
TGGACGACTTCTCGCGCATGAATATTGAGATAATATCCAACCTTCTCGAGAACTGTGGCCGCTACCTGCTGCGCAGCCCG
GAAACCTCTCCACGTATGGTTTCCTTCCTGGAGACCCTCCAGCGGAAGAAGACGATGCAGCACATCGGGCAGACCGAGAG
AATGTTGATCGAAAATGCCATATACTATGTGGACCCTCCGGAGCGGCCTGCCATCCAGCAGAAAGAGAGAACGCCTATGG
AGCTGTTTATCCGAAAGCTGCTGTACGTCGACCTGAGCAAGCGCAACGCCAACAAGATTCTAAGACAGGTCCAGAAGCTG
CACTGGGAGGAAAAGGAGGCAAGTATTCCTATTAGGCCTCAGTCGTTGTGTTTTTCACCCCTCTGTTCTGTGCCCTAACG
TCTGCGCCCAGGTCGTCGAGCTTTTGAGAAAGGCGTTTTCTCGTCCTTGGAAGGTCAAATATGGGAATGTGCATCTTCTT
GCCGGACTCCTCAGCGCTCTCTATCGGCACCATTCTGCTTTTGTCATCAATATTGTCGATGGCATTATCGAGTCGGTCAT
CTTCGGACTTGAACAGAATGACTTTCGTCAAAACCAGCGACGCCTCGCCGAAGTCAAGTATCTCGGGGAATTTTATACAT
ACCGCCTGCTGGAAAATCCTGTCATTTTTGACATGATGTACAAGATCTTGACGCTTGGTTATGGCGGGCCGCCTATACCC
GGCCGCCTCAACCCCTTGGATCTTCCGGATGAATATTTCCGCATCCGCCTCGTCGCCACTATTCTCGAGACCACAGGAAC
CTATTTCAACAAGGGTCCAGCAGGCAAGAAGTTGGATTACTTGCTATGCTTCTTCCAGGTGTGCATAATTCGTGCTATGC
GTATGTTGTGTTTCTACGACTAATACCGTCATCAAACAGTACTACATCTTCACAAAGAATCCTCTGCCGATGGACATCGA
GTTCATTGTTCAGGACACGTATGCTCTTGTCCGACCGCAGTGGAAGTTGGCAACCAATTTTGAGGAAGCACTCAAAGCAT
TTCAGCTTGCGAGAGCCCAAGACCAGAAGACTACGGGTGTCGAGAAGGTCATAGACCAAGACGACGGCGCTGCATCTGAT
GACGAGTCTTCAGAGGATGAAAACGAAAACGGGGATGATTTAGGTGTGGCCGAAGCGGAGGGCGACGAAGATGCATCTTC
GGCAGATGAAGACGGAGAGGTCTGTGCTTGTCTTCTAGGAATCGTTGGGCGCTCTGAAGGGACCAGCTAACCGATTATTT
GGCAATATTATAGGATGATGCCGACCAACGCGAGTCCGATCATAGTGAATCCGAAGACGAAGAAATCGTGGTAACTCGTG
AGGAGGAACTAGTCGATCCCGAGGAGGAAGCCGAGTTCGAGCGTGAGTATGCGAGGATTATGGCAGAGAGCCTGGAATCC
CGAAAGTTCGACCGCAAGCCCATGTTTGATGTTGCTCTTCCGGTCCGGGCAAAGGCACGCGAAACAAACATGACGCCTGT
AGACAGCGGCGACGGTGGCGATGCCGAGCAGCAAACACCAAGCGGAACGCCAACAATGTCGTTCTCTCTTCTCACGAAGC
GGGGGAATCGTCAGCAGACACGGACATTAGAGCTCCCGTCAGACTCCGATTTTGCGGTTGCTATGAGGAGCCAGCAACAG
GCTGAGCGCGAGGAGCAGCAGCGCATCAAGAACCTGGTGCTAAACCTGGACCTTCGTGAGAGCGAAGAGCTCGATGGTCA
GTACATCCGCAAAGCACCCCCTACTGAAAACCAGAACAGCAGTGTTTACCTTTAGCGTACAGACCCAGGACATGAGAAGC
CGACGTCGTACTTCCACAATCGACCCGATAAGGCGGGAAAAGACCGCTCACAACGCGTCCGCAAACTTCAACTGAGCGAC
GTAGACTGGTATGGCCCTCCTCCCAGCAGTGTCAGGCGGGGTTTGCATGGGTACGACAAGAGGGGACCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62