GenePrediction:GLEAN_7808 Details

Name: GLEAN_7808
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2883598..2881052 (- strand)
Length: 2547
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2883598..2883586 (- strand)
Length: 13
Type: CDS
Source: GLEAN
Position: GCSC_113:2883486..2883425 (- strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_113:2883366..2883335 (- strand)
Length: 32
Type: CDS
Source: GLEAN
Position: GCSC_113:2883263..2881787 (- strand)
Length: 1477
Type: CDS
Source: GLEAN
Position: GCSC_113:2881717..2881409 (- strand)
Length: 309
Type: CDS
Source: GLEAN
Position: GCSC_113:2881342..2881052 (- strand)
Length: 291
>GLEAN_7808 class=GenePrediction position=GCSC_113:2883598..2881052 (- strand)
ATGAGTGTTGTAGGTAGGTTTTGTTGGCCGTTGCAGACGGTTCCCCTGTCCTTCCCTTGGTTGCCGCTCTTCTATCCCAG
CGCCCAATATGTCTATACTAATCAATCTTCAGGTGTTGATTTCGGTGCCCTCAACACGGTCATTGCCGTGGCGAGGAACC
GTGGTGTCGATGTGGTACGTCTGATACCTTCCCTGCCCTTCCTTCTCGACCAAGTCCTAACGTCTCTGCCAGATTGCCAA
TGAAGTCTCTAACCGGGCAACTCCGTAAGCTCCTTTCGCTCTCGTCTGCTTGTCTTGTCTTTGCTGCATTGCCATACTGA
CCTTTGCTGCTGCAGTTCCCTCGTCGGATTCGGACCCAAGTCCCGTTACCTCGGTGAGGCTGCCAAGACACAGGAGATCT
CGAACCTTAAGAACACCGTCAGCTCCCTCAAGCGCCTCGCCGGCCGGTCAATTAAGGAAGCCGATGTGCAGCTCGAGCAG
CAGTTCATCTCAGCACCCCTGGTCGATGTCAATGGCCAGGTCGGCGCCGAGGTGTCCTACCTGGGCAAGAAGGAGAAGTT
CTCTGCCACGCAGCTCATCGGCATGTACCTCAGCAAGATCAAGCAGACCACCGCTGCCGAGATCCGCCTGCCCGTGTCGG
ACCTGGTGATGAGCGTGCCGGTGTGGTTCACGGATGCTCAGCGTCGTGCCCTCATCGACGCTGCCGAGATCGCCGGCCTG
CGGCTGCTTCGCCTGATCAACGACACCACCGCTGCCGCTCTCGGCTACGGCATCACCAAGCTGGACCTGCCTCCGCCGGA
GGAGAAGCCGCGCCGGGTGTTCTTCATCGACATCGGCCACTCCAACTACACCGCCTCTGTGGTTGAGTTCCACAAGGGCG
AGCTCACTGTCAAGGGCACTGCCTTCGACCGCCACTTTGGTGGCCGCAACTTCGACAAGGCCATTGTCGACCACCTGCAG
AAGGAGTTTCTCGGCAAGTACAAGATCGACATCAACTCGAACCCCCGTGCGGTGTCCCGGGTCTACGCCGCTGCCGAACG
GCTCAAGAAGATTCTCTCGGCCAACCTGCAGGCCCCCATCAACATCGAGTCGCTCATGAACGACATTGACGTGCAGTCCA
TGATGACGCGCCAGGAGTTTGAGGCTCTGGTCGACCCGCTGCTGTCGGGCGTCGTGGTGCCGCTCGAGCAGGCCCTGGCT
CAGGCCAAGCTGACCAAGGACGACATTGACGTCATCGAGCTTGTCGGTGCCGGCACTCGTGTGCCGTCGATCAAGGAGCG
CATCCAGGCCTTCTTCGGCAAGCAGCTGTCGTTCACGCTGAACCAGGATGAGGCTATTGCTCGCGGCTGTGCCTTTAGCT
GCGCTATCATGTCGCCTGTGTTCCGTGTGCGCGACTTTGCCGTTCACGACCTGGTGACGTACCCGATCGAGTTCACGTGG
GAGAAGGCCAACGATATCCCTGACGAGGACCCGAACCTGGTTGTGTTTGGCAAGGGCAACGTCATGCCGTCGACCAAGGT
GCTGACCTTTTTTCGGAAACGGCCATTTGACCTGGAGGCACGCTACTACACGCCGGAAGAGCTGCCTGCCGGCATGCAGC
CCTGGATCGCACGGTTTTCCGTCAAGGGTGTCAAGCCGACGATCGGCGGGCCGGACGACTACATGACGTGCAAGCTGCGG
GCCCGCGTGAATATCAACGGTGTGCTGAACATTGAGAGCGCGTACTACGTGGAGGACCAGGAGGTCGAGGAGGAGATTAA
GGAGGACGAGGAGAAGAAGGAGGACGAGGCGGGCGAGAAGAAGGATGCGGACGTGAGTGCTTTCCGTTCCTTCTGTTCTT
CCTGTTTCTGTGGGAGTGGAGCCGAGCTAACCGGACAGCAGGCCATGGACACGGACGCTGCTAAGGACGAGGCCAAGCCG
AAGACGCGCAAGGTGCGCAAGCAGGTGCGCAAGGGCGAGCTGCCGATTGTGTCGGCGACGCAGACGATGGATCCGACGGC
CAAGAACGCGGCCATTGAGAAGGAGGCGGCGATGGTGATGGAGGACAAGCTTGTGGCCGACACGGAAGAGAAGAAGAACG
AGCTGGAGACGTTCATCTACGACCTGCGCAACAAGCTGGACGACCAGTATTCGGACTTTGCCAGCGATGCGGAGAAGACC
AAGATTCGCGAGAAGCTCGAGGCCAGCGAGGTGAGCCCATCTGGACTGACGTTTTGGACTGATGAAAGGATGATTTGTTT
TGCTGACTAATCACAGGACTGGTTGTACGACGAGGGCGAGGATGCGACCAAGGCGGTGTACATGGCCAAGATGGAAGAGC
TGCGCGCGCTGGCCGGTCCGATTGTGCAGCGCCACTTTGAGCACACGGAGGCGCAGCGTCAGGCGCTGCAGGCGCGGCTG
GACGCCGAGGCAGCCGCGAAGAAGGCGGCTGCTGGGACGGGCGGTGGCGAGGCCAAGGCCGAGGCCACGGATGCAGCACG
TGACGATGAGATGACGGATGCGGACGGCACGCAGACGACGGTGGAGGAGGTGCAGGAAGACCGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62