GenePrediction:GLEAN_7809 Details

Name: GLEAN_7809
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2868732..2866910 (- strand)
Length: 1823
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2868732..2868520 (- strand)
Length: 213
Type: CDS
Source: GLEAN
Position: GCSC_113:2868303..2868198 (- strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_113:2868139..2867960 (- strand)
Length: 180
Type: CDS
Source: GLEAN
Position: GCSC_113:2867889..2866910 (- strand)
Length: 980
>GLEAN_7809 class=GenePrediction position=GCSC_113:2868732..2866910 (- strand)
ATGGCCGACTATCCCACCGAAGACGCCAGCCTGCCACCGGCGGCAGAGAGCTGGCCCAAAAGACGCAGCCTGTCGAGGTC
GCCGGAGCGGCAGCCGAGCACGACAGGCACGGAGATGGCAGGCACGGAGATGACAGACACGGAAATGACAGATGCCACGG
AGAGCATGGCAGACCCGACGGCGTCTGACAGGACGTCATCCCGAGCAACGTCGGTAACAGCTGAGGACGAGCACTTCGAA
GCTGACGAGAAAGGGGACGAGAAAGAGGAAGATGAAGGGATCAAGGAAGAGATGGTCGAAGAAGAGGGCGACATGAAGGA
AGAGGATGTGTTCAAAGAAAAGAAGGTCGAAGAGGAAAAGGAAGAGGATGAGATCAAAGAAGAGAAGGTCGAAGAGGAAG
AGGAAGAAGACCCAGCCTATGCTGCCAAGGTGCAGCAGATCCGCAGCGCCTGCATCCACGGGGATCTGGCCGAACTGCAG
TCACTGGCCGCGTCGGAAGGCGGTCTCCTCACAGACGAGCTCCGCCAGGTTGCATGTATGTGTTCGCCCAGGGTGCAGCA
GCCGCTCTAACTCTATGCTGACTAAGCAAACAGGGCCCGTGCTGCTCGGACTGCCTGTAGATGGCGACGGCCGGGTGGAC
GAGAAGGCAGCGGCAGCCAAGGCGGGCATGGCGGTCGACGAGGGAGATGCATCCTGGCAGAATCTTCCGGCTCATCGGGA
CGAGGAGCAGGTGCAGCTGGACGTCAACCGGGCGTTTGTGTACTATCCGATCCGTGAGTCTGCAGTGAAATCCCCCCTCT
TCACTTTCGGCACGCTCTTTCTGACAGGTCGATGTTCTCGCAGACGCGTCCCCGGTCGAGGAAGCACGCCAGCGCCGGGC
GCTGTCAGACCTGATCGTGGAGGTGCTCCGGCGCCAGCCGTTCCTGTGCTACTTCCAGGGCTTCCACGACATCTGCCAGG
TGCTGCTGCTGGTGCTGCCGCCGGGTCTGCGCACGCCGGCAGTGCTGCGGCTGGCGGTGCTGCGCATCCGCGACTTCATG
CTGCCGACCATCGACGCGGCCGTGACGCAGCTGCAGCTGCTGCCCGACATCTTGCAGCTGGCCGACCGGCCGCTCTGGAC
ACATCTGCACCTGGCCCAGCATCCACGTCCGTTCTTCGCCCTCGGCGGCACCCTCACCATGTACGCCCACGACATGCGGT
CACTCGGGGCCATCGCCCGCGTTTTTGACGTCCTGCTGGCCCGCCCGCCCGACTTCTCGCTCTACCTCTTCGCCGCCATC
GTCTGCGCCCATCGCTCCGCCCTCTTCGCCACTCCCGCCGACGAGCCCGAAATGCTGCACCACATCCTGTCCCGGCTGCC
CGGCGATGCCGGAGACCCTGTCGATGGCGAGACTCCGCCTGGCCACCATCTCGACCTTCTCGTCGCTGATGCCGCCCGTC
TCGCCGACCGTTTCCCCCCCCATGTTCTGCCCGCCTGGCGCGCCGTCTCGGCTGCCTCCGTCCTCAAGACTGCTCAGCGC
CCCGGTGGCATCGTCGCTCAGTCCGTCGCCGATGGCGAACGCCTCTTCCGCACCCACGTCCGCGAGCTCGATCGCGCCGA
CCGCCATCGCCTCCGTCGCGCCCATCTCCACAAGATGCTCATACAATACCGCACTCCCCTCCGGGCCGTCGGCGTCGCCG
TCCTCGTCGGCGTCCTCGCCATCTGGCTGCGTCGCGCTGGTCCAACCGGCACGTCGTCCGCCACCTCGCTGGGCAACCTG
CTCGCTAGGCCCTTCACTGCTGCTGCCTCGGGGCTGTCGCGTCTCGGCATACGCTTTACCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62