GenePrediction:GLEAN_780 Details

Name: GLEAN_780
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:2048536..2050802 (+ strand)
Length: 2267
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:2048536..2048876 (+ strand)
Length: 341
Type: CDS
Source: GLEAN
Position: GCSC_97:2048947..2049526 (+ strand)
Length: 580
Type: CDS
Source: GLEAN
Position: GCSC_97:2049577..2049702 (+ strand)
Length: 126
Type: CDS
Source: GLEAN
Position: GCSC_97:2049757..2050607 (+ strand)
Length: 851
Type: CDS
Source: GLEAN
Position: GCSC_97:2050676..2050802 (+ strand)
Length: 127
>GLEAN_780 class=GenePrediction position=GCSC_97:2048536..2050802 (+ strand)
ATGGCGTCCCCTCTCCCCCATCCACTATCTGCCCTCAGCATCGAGGAGACCAACCAAGCACGCGAAATTGTTCTCAGTCT
GCATCCAAACACTGTCATCGACTTCCGTACCATCTACTTGCTTGAGCCGCCCAAGGCAAAGACCGTGCCATTCTTGCAGA
TCGAGCACGCGGGAAAACTAACACCAAGTACACCAAGACCACCACGGCTGGCTGAAGTCTGCTATGATGTGATAGGTGGT
TCCAAGGTGCCAGAGTACCATGAGTCGGTTGTCGATCTGCGCTTGCACAAGCGTACCACCCACAAGATCGTCGACACAGA
GTACCATGCCAATCTGAGCATGTAAGATAGCTCCGTTCTGCATTTTGCATGTTGCATTCTTCCGCACACTGCGGCTTACT
CCTACTTCTAGCTTCGAGTTTGAAACTGTAGTCACCACAATCAAAAACTCGACGCTTTTTCAGGAGAAGCTCAAGGCCAT
CAAGCTGCCAGAGGGTTTTGACGTTGTCATTGAGCCCTGGCCTTACGGGGGCCCTGACCTAACCGATGGCCCCGCCCGTC
TTTTCCAGGGCCTGTGCTTTGGGCGTGACACTCGCAGCGGCAATCCCGACGTCAATTTCTATGCATATCCCATTCCCCTG
ATCCCTATTGTGGACGCCAACAAGCGTGAGCTTGTGCGTGTGGACGAACCGGCCACCGGCGGCAAGGGCGATCTCTTGAC
GGGCAAGACGAGCAAGACAGCCCGCATCCTCGACCATTGTCGGCCAGCTGAATATGTGCCAGAGCTTCTGCCCGGTGGTA
CACGCAAGGATGTGAAGCCTTTGACTGTAGTACAATCTGAAGGGCCAAGTTTTGCGATATCTGGCGATAATCTGGTCCAG
TGGCAGAAGTGGCGGATGCGGCTCTCATTTAACCCGCGCGAGGGCGCCGTCCTACACGACATCAGCTACGATGGCCGAGA
TGTCATGTACCGGCTAAGCATAAGTGATATGGTGTGTGTCCTTGATGCGCCTCTTGTGTAGCCTGCTAACAACCGGCACA
GACGGTCCCATATGGTGACCCGCGGCCCCCTTATCATCGAAAGCAAGCGTTTGATTTCGGCGACGGCGGCCTGGGTCACG
CGGTGAACAATCTCACACTGGGCTGTGACTGCCTTGGTGTAATAAAGGTGAGTTTTCTCAAGCGTTAGCTGAGATGTGCA
TATGGCTGACTAATGTCGTAGTACTTTGATGGCGTCCTGACAAAGGCCGACGGCACGGCTGTGGCCACCAAGAATGTTAT
CTGCCTGCACGAACAGGACAACGGCATTGGATGGAAGCACACGAATTGGCGCACCGGACGTGCTGTATCCACTCGTCGCC
GTGAACTTGTCGTCCAATTTATCATCACCCTTGCGAACTACGAGTACATCTTCGCATTCAAGTTTGATCAGGCCGCCGGT
ATTGAAGTCGAGGCCCGCGCCACTGGTGTCGTGTCGGTTGTCAACATTGACGCTGGGGCTGCCCCGCCTAACTGGGGAAA
TATCGTAAGTCCAGGTGCCCTGGCCCAGAATCACCAGCACATGTTCTGCCTTCGTATCGATCCGGCTGTGGATGGCCACA
ACAATACACTCGTGCAGGAGGAGAGCTTACCCGCTGTCGCCTCTAACCCGGCCACCAACCCCAACGGCAACTACTACGAG
GTCTGCCAGACACCCATCTCCACCTCGACCTCTCTCGATCTGGAGCCTACCCGCCACCGTGTCTTCAAAATTCAGAATCG
GAGTCGCATCAACCCTGTCAGCGGCCGACCTGTCTCCTACAAAGTCCTGGCCCCACCTACGCAGCTACTGCTGGCCCACC
CTGACAGCATTCAGTCTCAGCGCGCCTTGTTTGCCCGCCATCACTTATGGGTCACTCGCTATCGCGATTATGAGCTGTAC
GCAGGTGGACGTTATACCCTGCAGAGCCGGCGGGAGGTCGGTGGCGTGGCAGACGCAGCAGCGCGTAACGAGAATGTGTT
AGATGAGGACATTGTTTTGTGGAGTGTGTTTGGCCTAACCCATAATCCACGCGTCGAAGACTGGCCTGTCATGTAAGATT
CTCGCCCGCTATCTCCTGACTTGTGATGTTTTGTATACGAAGGCGGCTGACCACAGACAGGCCGGTGGAAATGCTCAAGG
TACAGATCATTCCATCAGACTTCTTCGTCAGCAACCCGGCTCTAGATGTACCCTCAGACATTGATGGCCAGTCTAAGCTA
GCAAGCACCTGTTGCGATAAGGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62