GenePrediction:GLEAN_7810 Details

Name: GLEAN_7810
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2863355..2862352 (- strand)
Length: 1004
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2863355..2863338 (- strand)
Length: 18
Type: CDS
Source: GLEAN
Position: GCSC_113:2862954..2862688 (- strand)
Length: 267
Type: CDS
Source: GLEAN
Position: GCSC_113:2862613..2862481 (- strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_113:2862422..2862352 (- strand)
Length: 71
>GLEAN_7810 class=GenePrediction position=GCSC_113:2863355..2862352 (- strand)
ATGGCGGACGACTCTCAGGTAACACCCCTGCTTCCTTGTTTCGATATTATGGGCGCAAACCCACCGGGACGAGGGCATAG
AAGAGAAAGAGGCCAAAAAACCTGTCACCCCGCAATCGCGCACCCCCGCGAACCGCAACCAGGGCTCGCAACCGGCAGCA
TTCGCTTGTCGCCTGGTGATCTCTTTTGTCCCGGTGATTTCACTGTGGCACAAAAGTCTCACGGGTGACTGCCGAGTCTT
GCGTCTGACGGGCTGTGGCTTGGCCCGCAGAGGTGCTCAGAGCCTTGCCTTGGGACACACAGTTCTTCTTTCAACCTCTT
TCTCTCGCTCCCGCGCGGCTGACTGTCTTCAATTCAGCCCGTCTCGTTTATCGCATTTTACTAACAGTGGCCGCGATGTA
GCATGAGCACACCTTCGACTCCGCCGATGCCGGCGCCTCGGCCACGTTCCCCATGCAGTGCTCTGCTCTGAGGAAGAACG
GTCACGTCGTCATCAAGGGCCGCCCCTGCAAGATTGTCGACATGTCGACCTCCAAGACTGGCAAGCACGGTCATGCCAAG
GTCCATCTTGTTGCTATTGACATCTTCACTGGCAAGAAGCTCGAAGATCTGTGCCCGTCCACCCACAACATGGACGTCCC
CAACGTCACCCGCCGCGAGTACCAGCTTGTAAGAAAACCACAGTCCTTTCCGTTGCACGTCCTTCGTCCAGCCTGTACCC
GTCTGCTGACACTCTGAACCAGTTGGACATCTCCGACGATGGCTACCTCTCCCTCATGAGCGACGACGGTGATACCAAGG
ATGATGTCAAGATGCCCGACGGCGAGATTGGCGAGAAGATCAACAAGCTCTTCAAGGTCGATGAGAAGGACACCAGTAAG
ACCCTCTTTTTTTTACGATGGATACGAGCAGCACCACTAACATTACGAAACAGACGTCATCATTCTCACTGCCATGGGCG
AGGAGTGCGCTGTTGAGGCCAAGGAGGCCCCGCGTGCCGCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62