GenePrediction:GLEAN_7811 Details

Name: GLEAN_7811
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2859624..2857525 (- strand)
Length: 2100
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2859624..2859496 (- strand)
Length: 129
Type: CDS
Source: GLEAN
Position: GCSC_113:2859422..2858703 (- strand)
Length: 720
Type: CDS
Source: GLEAN
Position: GCSC_113:2858634..2858424 (- strand)
Length: 211
Type: CDS
Source: GLEAN
Position: GCSC_113:2858353..2857934 (- strand)
Length: 420
Type: CDS
Source: GLEAN
Position: GCSC_113:2857862..2857525 (- strand)
Length: 338
>GLEAN_7811 class=GenePrediction position=GCSC_113:2859624..2857525 (- strand)
ATGGACCTCGGCCATGGCAGACGCGCGCTGCATCGCTTTCGCAAGGGCGAGACATGTGACGATTGCAACGCGCGGCGCTG
GTATTCCGACAGCGGTTTTCATTACTGCGAACGTGGTCATCTGATTGAAGTGCGTCAGTCTTTCTCGCCAATCTCTCTTT
TGGGCTACTGCAGTGACTTACGTCGGCTAACCTTTTCGCTAGTCTTTTATTCCCTTCGATCAGGAAGACGAGGACAACTT
TGGTGGTGGCGGCCACGTCGCTCGCGTGCAGAAAGAAACTCGTCATAAGGAGGCGCGTCATCTGTCAGGGATCGCCGCCC
GTGAGCTTTTTCTCGAGTGCCTGCAGCTGTTGCTACGCCGGCAGGTCGCGTGGCTGCAGCAGCGCCAGCAGTATGCTGAC
CACGATGATGCTCCGCCTCCGGCTGCTGCGCTCGAGTCTGTAGTTCGCGACCTTTGGGAGCTGCGCGTCCGCGACTTTAA
CGGCCTCACGGTACTGTCGACCGGGACATCGCGCGAGACAAGTCGCAGCCGTAGTCGCAGTCGCAGTCGGAGCCGCAGTC
GCAGCCGGAGCCGGAGCCGGAGCCAGAGTGCAGGCATCATTGATGGCGACGGCAACACTGACGGAATTTCAGACTTGGAT
GAGGACATCCGCACGGTGTACAGCTCTCAGCCGGACAGCGACTGGGGAGGACACAACAGTGCCGGCGGTATGTTTGGCGG
CCGGCCACAGCGTCGTGGCCTCAAGAAGCGAGTGCGCAGCATGCGGCAGTGGAAGTCGGCACCAGACGCACGGTGGAACC
TGCCGGCTGTCGTGGAGACGCTGGCACTCTGCTATCTGGGCGGCGTGTTGCTGCGGCTGCCATACCGCTTGGGAGACTTT
TTCCGCTGGGCAAAGAACGATCAGATTCCCTTTTTAGGAGCGGTACGTGATTGCATCTGAGTAGAAATCTCGGCTCTCTG
GAGCAAAGTACGGCTGACAGCTCTCTACAGATCGGCTACATGCCCAAGGCTATGAGGGAGCGGTTGCCACCGGGGTATCA
GGCTACGCTGCTGATGCGCAACACCACTTTTGAAGGCGGCAGCCTCCACAAAACTGTGTCCTACCTAGCACGTGGGTTCT
ACAGCAACCATGCGCTTCGGTTTCCTGGCCTCAATGTGCCGCCTCTTCTCTGGCGCTGGATGCGCCAGCTGGGACTGCCA
AGTGTGTATCCTTCCACCCCATTTGCTCGTTTGTGCCCTGTCTCTGCTTCAGCTCACTGATCGCTTTGCAGTCGAGGTCT
ACGTGGGCGTTCAAGAGATAGTGCGGCTCTCCCAGGAGGACTTCTGCTACCCATTGGAGCAGCCTGGCTTTACCTGGTTA
GACCACCCGGACGTTTTCCTCTTGGCGAGCATCGTTTTTGTCACGAAGTTGCTCTTCCCATTCCGAGGCCACGAACAAGG
CACCAGTGTCGGCGCAGCAGAGATGAACCCCAGCGAGGGTGGAGGCCCAGCCAGATCTGCCGCCCTCCACATGGATTGGC
ATAGGTGGCAGGCTATCTTCCGCGAGGTTCAGGATCCATCAGAGCCCACTGAGAAGCTGGATAGGCGGGAGATGGAGAAG
TTGCGGTCAGCCGATGCCTGGCGCATGACTGGAGATCAGGTGGACGACTATCTCGACTGGTACCAGGAAGTCCGCCTCAA
GGAGAGAGACGGTATGTTTCCAATTTCAAGCCCGTTGATTCGCGAAGTGGTGGCGACTTTACTGACGATTGATGTCGAAC
AGACCACCGTCATCTCCTGCGTCTGTTCCCCCTTCAGGACACACGGCCACCCCCCGTGGTACAGGAGGAGTTTGAGGAGT
CTATCGATGAGCGCTACCGTCAGGTACAAGGATCATGTCTTACGACGGCAGAGTCACCATTTGGCCGCAACGTGGTATAC
TACCGGCAAGAAAAGGACTTGCCAGAAACCGCGCAAGCATTCTACAACAGGGCAGCCAGCTTGGGAGGTATCACGGTCCA
GATCCTGGTCCGCAGTGTCTACAAATTGGAGCGGCGATGGAAGGCGTGGTCCAACATCAATGCTGCTGGCACAGAGCTGG
CAATGATGGTGGATGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62