GenePrediction:GLEAN_7813 Details

Name: GLEAN_7813
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2856066..2855007 (- strand)
Length: 1060
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2856066..2856022 (- strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_113:2855899..2855485 (- strand)
Length: 415
Type: CDS
Source: GLEAN
Position: GCSC_113:2855422..2855007 (- strand)
Length: 416
>GLEAN_7813 class=GenePrediction position=GCSC_113:2856066..2855007 (- strand)
ATGGCAGGAGCAGGATATGACGCCGTGGTGGATGTGGACGACGAGGTGAGCGAGGTCTTTTATTTGTTTTTGGGTTTGTT
CATCGGCTAGACAGCTGCTGGACGTGGCCATGCGTGTGTGTGTGTCTTTCGCCGGACGGCTATCTGACCGGCGATTGTGA
AAAACAGGGCGACCTCGGCCACACCGATCTGCAGGACGACCTCGAGTTCCACAACTCCAGCTTCGTCGACACGGCCGGAC
GCAAGAGCACGCCAGGTGCAGGCGTTGGGCTGCCGCTGCCGGCGACGGCCTCGCGGCCGGGCGGTACAGCTGGCGCGGCA
GGCGGCAAGCAGTTTCTCTGGTCGCTGTCATACTACGCACAGTTCTTTGACGTGGACACATCGGCGGTGTTGACGCGCTG
CTGGGCGGCGCTGTATCCGCGGGCCAACTTCTTGGACGTGCTCGAGGGCAACCCGGACCTGTACGGACCGTTTTGGATCG
CCACGACGGTCGTCTTCATCCTCTTCCTCAGCGGCACCATCAGCCATTACCTGGCCTCGACGGGCGACGAGCCGTTTGCC
TACGACTTCACCCTGCTGAGCGGTGAGCTGCCCTGATGTCTCTCCCCTCTTCTTCCTGTCCTTGCTCGCCCGCTGACTCT
TCAGGTGCCGCCGGCCTCGTCTACGGCTACACGCTCGTCATCCCGGTCCTCCTCTTCCTGGCGCTGCGCTACTTCGGGTC
CGAATCGGCCAACCTGCTCGAGTGCTGGGCCCTCTACGGCTACGGCAACCTGATCTGGGTCCCTGTCGCGCTCATCGCCT
GGTCGCACGTTGACATTCTCAACTGGGTCTTTGTCGCCGTCGGCTTCGGCCTCTCTGTCGCCTTTTTGCTGCGCAACCTG
TACCCCGTCCTGTCGGCCACCGACAAGCAGACAAGCAAGGTCCTTCTCGCCATCGTCGTCGTCCTGCACATGGCCCTCTC
TGTCACGATCAAGTTCCTATTCTTTGCGCACGCCAGCCCGATCAAGAGCCCGCTGTCGGGAAACAAGCCGCCCGTAGAGA
CACCGCCCAGCCTGTTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62