GenePrediction:GLEAN_7814 Details

Name: GLEAN_7814
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2850050..2849788 (- strand)
Length: 263
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2850050..2850037 (- strand)
Length: 14
Type: CDS
Source: GLEAN
Position: GCSC_113:2849977..2849788 (- strand)
Length: 190
>GLEAN_7814 class=GenePrediction position=GCSC_113:2850050..2849788 (- strand)
ATGTCTCTTTGGAAGTGAGCCTTTCACCCGCACCCCATCGCCTGTCATATTCGGCGTCTGACCGTATTCTTAGATCGTAC
CGCGCACTTTCGCCAACCACCCGCTTTGGCGTTGGCATTGGTGTGCTGTTTTGGGGCACGGCTGGCCTGTACTTTTCGGA
TTCGGCTGCCGACCGCATGGGCATGACACCGACAGAGGCAGACCGGCAGTCCCTGGACAAGATGATGCCAAAGATCCATG
TCGTTGATCCCCAGGAGAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62