GenePrediction:GLEAN_7815 Details

Name: GLEAN_7815
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2834504..2833137 (- strand)
Length: 1368
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2834504..2834267 (- strand)
Length: 238
Type: CDS
Source: GLEAN
Position: GCSC_113:2834171..2833505 (- strand)
Length: 667
Type: CDS
Source: GLEAN
Position: GCSC_113:2833269..2833137 (- strand)
Length: 133
>GLEAN_7815 class=GenePrediction position=GCSC_113:2834504..2833137 (- strand)
ATGCCGCCCAAGAAGAGAGGGCGTACGAGCGCGGCGCAGGCGGCAGCGACGCCGAGCCGTGACGACGATGCCATGGACCT
CGACACGCCGCAGGCAGCCGAGACGCCGACAATTTCGGGCTCCGAGCCGGCGGCCAAGGCGGTTTTTCGGACGGCGGCGC
CCAGTCCGCTGGAGAGCTGCTGGACCTCGGAGCAGAAGGCGGGGCTTTTCTCGGCCGTCATCCGGTGGAAGCCGTCCGGT
GGGTTTGACTTTGAAGCTTCGCCCTTCTGGCTGTTCCATCAGCTCATCAGCTCGTCTGCTCATCCTCTTCATCGGCTGAC
ATCAGCCGCTCAGGCATGCACAGACACTTCCGCATGATTGCCATCTCTGAGCACCTGCGCTGCCGCGGCTTCGATCCCGA
CGTCTGCCAGCACACCCGCATCCCGGGCATCTGGAAGGAGCTCTGCACCGAGTACGAGCTCGAGGCCATCAACGACCGCG
ACAACTCGCTCGACCTTGCCGCCGACAGCCAGCCGGGCCACGACACCCGCTACAAGGAGTTTGCCCTGCCGCTCGACGAC
TTCCGCGACGCCATGCTGGACCGCGCCCTCGTCGAGAGCGTCGAGGCCGACGGCGATGGCGGCAGTGGCGGCCGCTCGGC
TGCCACCTCGCCCGCCCAGTGGGATCCAGACGCATCATCGCCGCCGCCGACGACCGCCTCGTCTCATCCCGCCTCGACGG
GCATCGCGTTCGAACCGGCGGCCGCGCGACCCAGCGTCGCCAAGCGCAAGCGCGGCGAGATGGCGCACGCCGCTCTGCGC
ACGCGCTCGTCTACCGTCGAGAGCTCCGAGATGGTCACGTCGTCGGCCGCATCGCCCGCTGCTACAGCCCACGCCGCGCG
CGGCTCTCGACGTGGGAAGCGCGGCGGTGGTGCGGCCAAGCCCGGCCGACGGAAACCAGCGCCGCGAGCGAAGCACGAAG
ACGACGACAGCGACGACGACAGCGATGATGTCGAGGGCCGGTCGGCAACGGCCAGCGAAGGAGATGAGGACCGCAGAGGA
GGCGACAGCGAGGATGAGGGCGAAGGGGATGGCGACGACGATGATGACGATGGCGATGACGACGACGACGGCGACGACGA
CGACAATTCGGATGACGACGACGACGACGACGATGACGACGACGACGACGATGACGACGACGATGATGATGTTGATGCCG
ACGTCAAGGACGAGGAGGAAGAGGTCGAGGAAAAGGTCAGAGCACCACCACCAAGAGCGACACGAGGAGGCGGTCGTGGC
CGAGGTCGTGGTCGTGGACGAGGACGAGGACGAGGACGGGGACGGGGAAGATGATAGACCTGAAGATGGACAGGTGGACA
GCAGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62