GenePrediction:GLEAN_7816 Details

Name: GLEAN_7816
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2826126..2822631 (- strand)
Length: 3496
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2826126..2826042 (- strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_113:2825980..2825874 (- strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_113:2825814..2824786 (- strand)
Length: 1029
Type: CDS
Source: GLEAN
Position: GCSC_113:2824409..2824284 (- strand)
Length: 126
Type: CDS
Source: GLEAN
Position: GCSC_113:2824226..2824208 (- strand)
Length: 19
Type: CDS
Source: GLEAN
Position: GCSC_113:2824145..2824088 (- strand)
Length: 58
Type: CDS
Source: GLEAN
Position: GCSC_113:2824017..2823787 (- strand)
Length: 231
Type: CDS
Source: GLEAN
Position: GCSC_113:2823730..2823425 (- strand)
Length: 306
Type: CDS
Source: GLEAN
Position: GCSC_113:2823376..2823288 (- strand)
Length: 89
Type: CDS
Source: GLEAN
Position: GCSC_113:2823232..2822990 (- strand)
Length: 243
Type: CDS
Source: GLEAN
Position: GCSC_113:2822926..2822631 (- strand)
Length: 296
>GLEAN_7816 class=GenePrediction position=GCSC_113:2826126..2822631 (- strand)
ATGGCCACAAAGGAAGAACTCTTTGACTTTTCGCATTTCGACATCAATGCCATCCTGCGGGGTGCACAGCTCACGCTCGT
GGGTGGTGCGTGACTTCCCAGCATGTCGTTTTTTGCTTGCCAAACCGCTCAGCTGACACATCCCAGCCCAACGAGCTTTG
CAGAACCCCGGCCTCTGGACGACGCAGCATTACCGACAGGCGGTCATTGCCGTGGGCTGCGGCATAGTGATCCGGCTGCT
GGTGGAGATTCCGGTGCGAGACCTTCCCCTCCATACTGAAAGATCACGTGCTCACTCCTCGTCCACTGTTAGATCATTGC
CCTTCGTATCGTGCTCTGGGTGCTCGGCTTGTTCATGGAGCTCGACGCAATGACATGGGACGACTCGATCGTGGACGGGC
TGCGCTTCCTGCAGTCGAACGTGCTGCAGGTGCCGCTGTTCATGATGTCGCTGATGCGGCACATCACGCCGGCCATGGAC
GAGCTCTTCATGCTATCGCTGCAGTGGGTCGACCACACGTACGCGCAGAAGCACGAGCACGAGCGCCCCGACGGCATCGA
TCCGCACCAGCGCTACTACGAGAACCTACGGCAGTACGGCGATGCGGGCCGGCAGCTGAAGCGGCAGGGCCAGGGCCAAG
CCCAAGACTCCTCGGCAGGCGGCAGCGGGCTCACGCGCTTCCTGAAGCGCTTTGCCCGCAAGACAGGCATCTCGCTGGCC
GTGTATGCGTTGTCTTTCTTGCCGGTCGTCGGCCGCTTCGTACTGCCGGCCGCGAGCTTCTACACCTTCCGCCACGCTGT
CGGTCTCGGCCCGGCCGCCGTGGTGTTCCTGGGCGGCGGCCTGCTTCTGCCGCGACGCTATCTCGTCGTCTTCATCCAGA
CGTACTACGGCCAGCGCAGCCTCATGCGCGAGCTCCTGGGACCGTATTTTTCGCGCGTCAGCTTCTCTGCCGCCCAGAAG
CGCAGCTGGTTCCATAGCCGCGAGGGCCTGCTGTTCGGCTTCGGCGCCGGCTTCTATATGATGCTGCGCGTGCCCTTCTT
TGGTGTCTTCATCTACGGCATCGCTGAGGCGTCCACGGCCTACCTCGTCACTAAGATCACCGACCCGCCGCCGGCCGCCG
CCGTTATGGCTTCCGGTGTCGATGCCACGTCTGCCGTGGCCGTGCGTGCAGCCTATGCCGACGGCCAGCAGCAGTGGCGC
AACAAAAAAGCCTTTCTCGAGCTGGCCCTTGACAATCTGGATGCCATGCAGCGGCAGCACGGCGGCACCGGCAGCAAGAT
TGTCCGCAGCAGCAGCAGCGGCAACGACACCGGCAGCACAGCCATCATCGAGGACCCCGTTGTGCGTCGACGCTACAACG
ATGATCCACCACCGGCATACTCGCCCGTTGCCAAGCAGTGAGCGAACTGTCCTGGAGGATGGAATGATAGCGTTTCGGGG
CCCAGAAGCGCCGTCGGGCTTTTTGCAATCAAGATATTTCAATTCAATCCACCGCTATCATTGGCTGTTGTCTGCTGTTG
GCGCTGTGATTACGTCGTTTTCTTTGCATTCTTTCGTTCTACCTTATCGTCTTAGTGTGGGGGTTGCCGTCACTGAGATG
TATCTTAGTACCCCGCGTTAATACTCTTCGGAGAAACGAGTAGCATATAGAAGGGACGACGGAGACGCGTCCGGCCAGGA
ATACAAGTATAACAAGACTTGAGCCCATGCCTGCCAGAAACAGCCGACCCAGCAAGCCAACACCGTGCCCGAAACAGCAG
TCGCAACCATGGGCAAAACCGGCATCCGTACCATCACCAAAGTGAGCTTCGATAAGCCTGCCTGGGAACAACCAGGCCTA
CATGTACGTTTCCCGGTTAGCTTGCATAGACAAACAGACTCGTTCTGACTCGCGCTTCAGAACCGATGGCACCCCGACAG
TATGTGAGATAGAATATCGTCGACGTGTGTGCTTGGTATCGGCAGCCATGCTGATCAGCAGTCCCCTTTTCTGGCACGAT
CCAGGACGGCGAGACGGTCAAGATTGAGTGTCTGGACTGGTGAGGAGATATTCTTTTTTCTCTTGAGCTCGAGTCTCTCT
CGCTGACGTCCCGCTCGCCGGCCTGACAGGACCGGCGGCCAGATCGGCAACAACGACTCGGCCGACGACCTGCTGCACGT
CGACCTCACCCGCATCCACTATCTGAGCGGGCCCTTTGAGATCTCCGGCGCCCAGCCGGGCGACCTGCTGCTCATCGAGA
TCATGGACGTCCAGCCGTTTGAAGACCAGCCCTGGGGCTTCACCGGCGTCTTTGACCGCCACAACGGCGGCGGCTTCCTC
GACGAGATCTACCCGACTGCGTGAGTCCTCAGCTTCTGTATAGGCCTCACAGCCCACACCTGCTCACATCCCCCAGAGCC
AAGGCTATCTGGGACTTTGAGGGCATCTCTTGCTCTTCGCGCCACATCCCCCACGTCAAGTTTGCCGGCCTCATCCACCC
TGGCATTCTGGGCTGCGCGCCCTCGGCCGAGGTGCTCGCTACCTGGAACAAGCGCGAGGGTGAGCTCATCGCGGCCAGCG
AGCTCGCCGATCGCGACGTCGCCCTGCCGCCCCAGCCGCTCAATGCTCACGCCGGAGCTGCCGACGCCGCCACCGCCGAG
CGCATCGGCCGCGAGGGCGCCCGCACTGTCCCGGGCCGCCCGGAGCACGGCGGCAACTGCGAGTGAGCAACTTCTCGCCC
CTCTCTCCCGTCGATATGCTGACCCGCCAGTATCAAAAACCTGAGCCGTGGCAGCAAGGTCTATCTGCCTGTTCATGTGG
CGGGCGCCAAGTTCAGCGTCGGTGACCTGCACTTTTCCCGTACGTCGTCTTTCCACACCCCCTCTTCCAGTATCTTGTTC
TAACGGCCTTGCAGAGGGCGATGGTGAGATATCCTTCTGTGGCGCCATCGAGATGGCCGGCATCATCACCATCAACTTCA
AGGTCATCAAGAACGGCATGGCCGATCTCAGCCTCAAGTCGCCCATCTACATCCCTGGGCCGGTCGAGCCGCAGTTTGGC
CCCGGCCGCTACATCTATTTCGAGGGCTTCAGCGTCGACCAGAACGGCAAGCAGCACTATATGGACGTGACTGTTGCCTA
CCGGCAGACCATTCTTCGTGAGTCTCCCGCACGGTGTATCGGAATAGAGGCTGTGTCCTGACTCTGTCCCCCTTCCCTAG
GCTGCATTGAGTATCTCCGTCGCTTCGGCTACAACGACTACCAAATCTACCTCCTTTTATCGTGCGCTCCCGTCCAGGGC
CACGTCGCCGGCATTGTGGACATTCCCAACGCCTGCACCACGCTCGGCCTGCCGCACGACATCTTCGACTTTGACATTGG
CCCCGAGGCTGGTGCCGCCAAGAAACTTGATATGGGCAGCTGTGCCTATCCCACCGGCGTCACCGACGGCGTCGTCCTGG
CCGGTAGCTCCAACAGCAAAACTAGCTTTGGGGGAGGCTTGACGTACAAGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62