GenePrediction:GLEAN_7817 Details

Name: GLEAN_7817
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2822049..2821079 (- strand)
Length: 971
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2822049..2821828 (- strand)
Length: 222
Type: CDS
Source: GLEAN
Position: GCSC_113:2821747..2821079 (- strand)
Length: 669
>GLEAN_7817 class=GenePrediction position=GCSC_113:2822049..2821079 (- strand)
ATGGAGCCGCCCCACCGCTGCGGGTCCCGCACCCAGCGCGCATACTCGGCCGGCTCCTTGTTCTCGAGCACCACTTTGGA
GTACTTGTCTGGGTGCGCGAGGATGTGTTCGGCCACGCGCGCCCGGACCTCTACAGCCGGGTCCGGGATGCCGACGACGC
CGCCAAAGGCCGTAAACATGCAGCTGTTGTCGTCGGGCATGACGCGCAGAACTGGTGGCCAAGTCAGCAAGCAGGGCTTC
TTTAACGAGGAGAGAGCATGCACACGAGGGACGCACCCAGATAACCGCCGCCCTCGTCCCAGGGCACGACGGTCTCGTCG
ACATCGACGCCTTTGGGGACGAACGGCGGGGGCGCAGGGGTGCTTGATGTCGGTGCCGGAGCGGACTCGGACGCCGAAGG
GCCGCCACTGTCTGTCGGCACGAGCATGATGGTTGCGCCGTTCAGCTGCAGGGGGCCCAGCGTCATGGCGGCTGCGTCGG
CGAGGTCCAGCGGTGTCGGCGGGAAGCCCGTCTTGAGCGTGAAGCTCTGCACACCTGTCTTGTCGCGGATGAGCTCCAGC
AGCTGCGCCAGCGTCCAGTCGGCTGCGGCCTCCAGCGTGACGGTGGCGCTGGGGCCGCGGACGCGCATGCGGATCGAAGA
CATCGTATCGGGACGCGGGGATGAAGAAAGAGGGAGGGGGAATCGAGCGATAAGAAGCGGGTCTCAGGATGTGTTCTCCG
AGCTCTGCCTGTGCGGCCAATGGTCTTGTCCTGAGGTTGTATTTCTGGACAGGACGAAACAGCTCTGCAGGAAGCTCGAC
CAGAGTTCGGGCTGTGAGCAAGGTGGCGTGTATCGTAGGCTGCAGCAGACCAGGCCGAGGCTTCGCTCTGTTTCGTTGGG
CTTCTTTTGGGCCGCTTTCAGCAAACACAAACATAAGCGTGGGCTATCAGATTGTAGGGGGCAAATAGGGGGGCGGCTCT
TTACCTCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62