GenePrediction:GLEAN_7818 Details

Name: GLEAN_7818
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2820281..2816988 (- strand)
Length: 3294
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2820281..2819941 (- strand)
Length: 341
Type: CDS
Source: GLEAN
Position: GCSC_113:2819871..2819769 (- strand)
Length: 103
Type: CDS
Source: GLEAN
Position: GCSC_113:2819705..2818275 (- strand)
Length: 1431
Type: CDS
Source: GLEAN
Position: GCSC_113:2818148..2816988 (- strand)
Length: 1161
>GLEAN_7818 class=GenePrediction position=GCSC_113:2820281..2816988 (- strand)
ATGGCGGTGCAGAATGGAAGCGGAGGAGGACTGGGAGGACTGGGAGGACTGGGAGGACTGGGAGGACTGGGAGACGACGC
GTCGATGGAGGTGCGCGAGTCGATCGAGGCGAAAGCGACGTCGCTAGCGGATGCGGATGCGGACGCGGATGCGGATGCGG
ACGCGGACGCGGACGCGGATGGCGAGGCGGATCCAGACATTGAGATGACGGATGCGTCGGCCATGGACGTGGTATCGAGA
GCTGGGAGGAGCGTGACGGCATCGCGTCCGCCTCGCGACAGCCGCGACCTGTTGCAGCTGATCGACACGACGGCGAACTT
CCTCAGAGGCTACGAGGAGAAGTAGGTTTTTCTTTTTCTTCCACAGAGAAGCCGGGGGCTTCGGAGCTGACAGGGTCCTC
CCGCAAACAGTGGTCAGGAGATTGCGCTGGGATTCAACCGGATCCCCAACAAGCGACTTCTTCCGGATTACTTTGACGTG
ATCAAGGAGCCGGTTGCGTTCAGCACGATTCGGGTACGTTGTCTTCGGGACCAAGAGCAAGCAAGGTGATGGCACGGAGT
CTGACGCAAGATGCAGGGCAAGGTGCAGAAGAAGCAGTACTCAAGCTTCTCGCAGTTTGTGCGCGACGTAGCGCTGATCT
GCCACAATGCGCAGGTGTACAACCGGCCGTCGGCGCCGATCTTCCAGGACGCGATGCGACTACAGGCAGTGACCAAGGAG
AAGCTGCAGGAGCTGGTCCGAGACGGGTCGATCGGCGCGGAGGAGGCGGAGCTGCCGGACCTCGGAGAGATTCCTGACTT
CTCGCCATCACCAGAGGCCGAGGGCAACGACAGCGGGGAGGATTCAGAGGCGTCGGAGGAGTCGGAGGAATCAGATGACG
AAGAAGACGAGGACGACGCGGAGGACAACGGCGACGGCAACAACAACGGGACCGGACGGAGCGGCCGACGACAGCCGGGA
GGACGGACGCAAGGCAAGCATGGACAGCCGCCACGGCTGCTGACAGCGATGGAGGCACGGGTGCAAGCGGTGCTCCGGGG
ACTGCGGCAGATGCGGGACGCGGACGGCGACCGGCTGACGGAGGCGTTCGAGACGCTGCCAGACCGGACACAGCTGCCGG
AATACTACGAGGAAATCAAGCAGCCGATGGCGCTGGACGTGATCCGACGGCGGCTGCGGCGCAAGCAGTACAGCAGCGTG
GAGCAGGCGATGGCGGACGTGGAGCAAATGTGCAACAATGCGCAGCGATTCAACGAGGACGGCAGCGCGATCTTTGAGGC
AGCAGTGGCACTGCAGGGCCGAAGCCGCGAGCTGGCGGCCCAGCAGCTGAGCCGGCCAGACAGCGACTTCCGCGATGCAG
ACGGCCGATTGCCACTGACAGCGATCCCGGTGGCGGGCGGCAGCAGCAGCGATGCGTGGCGGGTGGGTGACTGGGTGCAC
CTGCGCAATGCCAACGACCCGGGCAAGCCGACGGTGGCACAGATCTTCCAGACGTGGGCGGACGCGTCGGGTGGCGCGTG
GATCAGTGCGTGCTGGTACTTCCGGCCGGAGCAGACGGTGCACCGGTTTGACCGGCACTTTTATGCACACGAGGTCTTCA
AGACGGCGCGCTACCACGTCCATCGGGTCGGCGACATTGTCGGCCGCTGCTTTGTTATGTCGGCACCACGCTTCATGGCC
GGCCGGCCGCGTGGACTGCCGGCCAACATCGCCGTCTATGTCTGCGCGGCTCGCTACAACGAGGTCACGTGCCGTTTCCA
CCACATCGACGCCGCGGCCTGGCCTGCCTGCCTGCCCCACGAGCTGCGTGACGCCGCCGCGGCCGGCTCCGACTACGCCC
TCGATCTCTTCCCGACGCCGCAGCGCCTGTTGCTGCTGCCCAGCCCCATCAAGCATCTCCTGCGCGAGGATGCCCGCGAG
ACCGACCCGCTGCCCAAGCCGACATACGGAAACCCCAATGCGCCTCCAATGGTAGGCGCCGTGCACCGCCGGCCGCGCCT
GCCTAATGTGCGTATTGTGCTTTTATGCTTTTGTGTCCCCCTCTCTGCCTGATTTTCCCGGCTGCCACGCTCTTAACCCC
ACCTGAGCCTCTCAGCTCTCGACAGCTCTCGATATACAACTGACACCCAACAGGAATCTCCCCCGCCCGAACCCCAGCTG
CCCGGCCAGGGACTCCCGTCTGAGATGCAGCTGGACCCGTCGCGACAGCCAGCATACCTCCATCCAGGCGTACCAGCCGG
CGCTATCCCATCGCCCTCGCCTCACGCTTCTTACGCTCAGCAGCAGTTTGTGCCGCGTCCCCGAACGATACCGGTGCCGC
CACAACATCAGCAGCCCATTGTTGCTCACCCTTCCGGCTCGCCACTGCCGCTCCAGTCCGGTCACCATCTGGCTCCGGCT
CCTGGAAATCCCCTCTTCGTGCCCCATGTCTTTGGCACGCCACAGCAGCAGCAACAACAGCAGCAGCCGGTGCCACAACC
ACCCATTGGCAACAACAACAACAACATCATGATGCCACAGGCTCTCCCGCCACAGCAGCAACAACAGGCTGGCGTGGTCG
GGATGCCCCCGGTGATGCCTCCCCAAACTGGCGGTGGCGCCTTTGATCCCCGCCTCCAGCAGCCGCAGATGCTGCACAAC
CGGATGGTATCGTCACCTGTGCCGACAGCGCGTGGACCACCTGCGACCCCCTCAGCTGCTGCTGCCATCGCGGTGCCGCC
GCCGACAGTGTTGCCGCCCTCGGGCCCGCCGATACCGACAGGCTACATTCCGCCGCGGCCGACGGCAGAGGCGTTTATTC
TGCCAGCCGACATCGACAGCTCGATCCCGGCCACCGTGCGCAAGCGCTACCACTGTGACAGCCAGGGTCGGGTCGTCTTC
TTCACGGCGCCGTCGGTGCGCCATGCCGTCGTGGGAGAGGGTGGTGAGGGCGGCAAGGGCGACGCCGACATCGACATCGA
CACCACAGCCGCTGTCGGGCTCGCACAAGAGTATGCCGGACTTGGCCACAGCGTGCGCTATCTGCACGGCCTAGACGACT
TCCGCGAGGAGCGGCGGCGCAAGCGCAAGGCCCGCGACGAGGCCTTGGCCGAAGAGGCCCGCGCGGCTGCCGAGCAGCAG
GCCCGTGACCAGGAGGACTCGGTCCGCCTATTGTACGGTGCCGCCGGCGAGGCCTTGGGCGGGCTCGTGCAGTGGATGAA
TGAAGGCACGCGAGCCGTCGAGGACAGCCTGGGCGGCTGGGAGACGCCGCAGACGGCGTCCAAGAAGCGTGCCGTCGTCA
GCGAGCAGTCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62