GenePrediction:GLEAN_7819 Details

Name: GLEAN_7819
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2812909..2812134 (- strand)
Length: 776
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2812909..2812385 (- strand)
Length: 525
Type: CDS
Source: GLEAN
Position: GCSC_113:2812315..2812229 (- strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_113:2812160..2812134 (- strand)
Length: 27
>GLEAN_7819 class=GenePrediction position=GCSC_113:2812909..2812134 (- strand)
ATGGCCGCTTCCATCCTCGACCTGTCGCCCGACAACATTGTCATCCGGCCGTTGTCCGTGGCCGACCACGCGGCCAGCAT
AGCCGTCGAGAATGCCGCCTTTACCAATCCGAATCACCGCGCCTCGCCTGACAAGCTTTCCTACCGCCTCACCGCCTGTC
CAGAGCTCAGTCTCGGCCTCTTTGCCAAAGCCACGGCTGCCGACGGTGAGCTGGAGATGGAGTCGGACGCCAGCGGCAAC
ATCCTCGTCGCCCACATCATCGCCACGCGCTGCCACGGTCGTCTGGCCTCGGACGCCAGCATGAACTACCCCAAGGACTG
GCGCACCACTCTGGCCACTACGGTCGCCACCGAAAATGGAACGCCCATCGGCCACGACCCCACTGGCACCACTGTGGCGC
TGCACTCGCTCGCCGTCGCCCCCGTGGCCCAGCGCAAGGGTGCCGGCTCACGTCTTGTCCAGGCGTTTGTCGACAAAATG
GGCCGCGACACGCCGGCCGACCACGTCGCCATCATCTGCCAGGATGTGAGTTTTGTTTGTGGGGGCAGGAAGCGTGGCTC
CTTTCGTGTTCCAGCACGCTGACTGATGTGCCAGTACCTCGTGAACTACTACAAGAAGCTCGGCTTCGCTCTCGTCGGTC
CCAGTGCTGCCCAATTTGGCGGCGGGGGCTGGTATGACATGGTGAGACAGGCCAGACGTTCTAGCCAACCCACCCTGTCT
CATTGGGAGACTTCTGACACTGCCTGCAGATATACGACCTGCCCAAGAGCACATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62