GenePrediction:GLEAN_7823 Details

Name: GLEAN_7823
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2774921..2771679 (- strand)
Length: 3243
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2774921..2774251 (- strand)
Length: 671
Type: CDS
Source: GLEAN
Position: GCSC_113:2774195..2774050 (- strand)
Length: 146
Type: CDS
Source: GLEAN
Position: GCSC_113:2773983..2773043 (- strand)
Length: 941
Type: CDS
Source: GLEAN
Position: GCSC_113:2772952..2772691 (- strand)
Length: 262
Type: CDS
Source: GLEAN
Position: GCSC_113:2772637..2771679 (- strand)
Length: 959
>GLEAN_7823 class=GenePrediction position=GCSC_113:2774921..2771679 (- strand)
ATGAACACGGGTGCGGTGGTCGGGAGCAGCAATGCCGGGAATGAACTTGGAAACGGGAGTGGAAGCGGGAGTGGAAATGG
AAATGGAGGTGGGAATGGCAACAACAGCGAGTCTGGCGGCGGACCGCAGCAGGGCCTCGACTCGCTGTCGCTCCTGCAGC
TGCGGCGTCTAGCGGCCGAGCTGCCGCGCAACGAGCCGGTCGCGTACGACTACGTGTATGAGGACACGGGCAGCTTCGAT
GAGGAGGTGGACGAATGGTTCTCCTACCAGATCTGGCAGTGGGTTCGCCTCAACAACGCCCAGCAGCACTTTGAGGCTCG
CTGGGAGCGTGAGCGCGTGGATGCCGGTCGCGACCTGGCCTGGGAGGCCGTCGAGCCCGACGTGCGCGAGCGCTTCGTCG
CCGGAGCCCTGGCTGTCCTGGCCGAGAACGAGACCAGACAGCGCCACCGCCACCGTCCCGAGGCCATTGGCGTGCTGCTG
TACGTCGTCCTCGGCCGCTGGGCAGCCACATGTGGTGGTCCGGCTGCCGGCGCCCGGAGGACCCCGGCAGTTCGCACCGT
TGCCCGCCAGCGACAGCTAGACGCCATTCGCGCCGGTGTCGCCCTCGTGGCCAAGGTCGGCGGCGCACCCGTGCTCTGGG
AGGCGCTGCGCAAGGCCTTTGAGCCATTCTGGTAGGCCGCTGCTGTCTCGTTTGTCACTGTCCATCCGTCCGGCTGACCG
CCTCAGGGGACCCGAAGACCCCCAGCAGCTGCCCTCGGCCGTCTTCCAGGACGCCCAGGACGAGTTGGCAAACCTCATGA
CCATCGTCTACGTGATGATGCAGGCAGTCCTGAGCAGTCCTCTGGACCTGGCGGCCAGCTACGTCAAGCTAGGTATGTGC
TCTGTCCTGTCCTGTCCTGTCCTGTCCTTTGTTGTCCTATCCTGTTCTGACAGAGAAGTGAGCCTGGAACCGCCAATACC
CGACTTCATGATGGCCGTGGCCTCCCGGCTGCGATGGGACGACAGCACGGTGATTCCGCAGTGCCAGGTGTTTTTGCTGC
TCTGGAAGTCGCTCCTGCTCGTCTTTGGCGGCTCCCGGGAGCTCGCCGAGACCAAGAAGGCCACGGCCGAGTCGACGGCC
GACGCCGACAAGGAGAAGAACCTGATCATGGCGTCACCGCTGGACTACCATGCCTTCCGGCAGGAGATCACATCCAAGTA
TCCGGCCTACATCCCGCCCCAGCCGCTGATCCCGCTCGAGGACGACAGCACGACCCTGCTGCCGCCGCTGCCGAACCAGG
CGTCTGCGCGCAGCAGCGCAGCCGGTGGCGTTCTTTCGGGGCCGCCCAGTGCCCACGGCGGCGCGTCGATTCTCAACCAG
CCGGTGCACATCGCCACGCCGGCACCATCGCCGCCGCCGTCGCCAGCCGCCGCCGGCAAGGGTGTCAAGAAGCAGAACTA
CCAGACGAACCAGAACTTTCCATTCATGTACCCGCCTCTGGACGCGACCAGCAATGGCGTGGGCGGCAAGGGTGCGGCCG
CGCTGCAGGACGTCCTCGTTGGCCGCAAGTGGGAGGGCAGCGACGTGCCGTCGTCCATCCTCGAGGCCGGTGAGCTGTTC
TCGAACCGCGTGCGCATGACCCGGGCGACGCGCCAGCTGTGGGAGGAGCGCGAGCGTTTTCTCAAATTTGAGCGCGGCTG
GGACTCGGCCGACGACGACCTGATCGAGGAGCTCGACCTGTCGTCGCTGACGCTGGCCGAGAAGGAGGAGCTGGGCCTCG
TGAAGCCGAGCGAGGTGCCGGCTGCCAAAAAGGACGAGTCCAACGCGGATCTCGGACCCCGGCCAGAGGAATTGAACGAG
CGGATAAAGCAGCGGCTGGATGCACTTGAGGATTTTTATGTGAGTGTTTTTGTTTGTGCTGTTTATTGGTTATTGTTGCT
GTTTTTTGAGCTTGCTCGCTTTCTTTTAATTTCCGCTAATCTGTTGCAGAGAGAGGCTCTGCCACACCTGCAATCCCTGG
TCATTGTCCTGCTCAAGACTGTCTTGATGAACGTGGCCGTTCTCATGGCCCAGGTACCCCAGAGCCAGCAACAACATCCG
GCCGCAACAGGCGCAAACGGCCGGGGCAACGGTGGCACGGAAGGCATGGAGCAGTCGGCCGAGGAGATCGACGCAGCTCG
GACGCGGGAGATTAGCAGCAAAGCCGTGTCGGGCATCCTACTGCTGCTGCTCAAGTGGCTGAAAGTCTCACGTAAGCACA
AACAAGCACAGACGGGAGCGAGCCTATGCTGACTAAGCACACAGATGTCCTCAAGTTCGAGTACCTGACACAGCTGCTGC
TCGACTGCAACTACGTGCCACTGCTGCTGAAGCTGTGGGCGCATCAGGACGTGCAGCAGCTGGTAGACAGCCGGACAGAC
CGGGTCGAGAGCGGCTTCTTCTACTTCTGCAACATCCGGGCTGGCGCACCAGAGCAGGACGGACCGGACGAGGAGGAGGA
CGAAGGGGACGCAGAGGAAGAGAGAGACGGGGAAGAAGACGGGGAGGATGAGGAGGAGAGCGAGGACGAGTGTGCGCCAC
CGGCGATCAAGCGGCAGCGATCACCGCAGCAGGCCGCCGCAGCAGGACCGACATCGACAGCCACGGCAGGAGCATCGACG
AGCGCCGAGGCGTTTAGCAGCCAGCTGGGACGGCGGCTGGAAGTGGATGAGTTCGGCTATCCGATTGGCGACGTGGCGGC
GGAGCCGATCACAGAGTTCAACCGGCGCAATTTCTTTTCGCTGATCAACCTGCTGCGGGTGATGCAGAAGATCTGCAAGA
ACAAGGCGCACCGCAACCTGCTGCTGGTGCACTACAAGTCGTCCAACATCTTGCGCAAGATGCTCAAGGTGCCACAGCCA
GAGCTGCGGCTATACACGCTGAAACTGTTCAAGAACCAGGTGCCGTACTGCGGGCGCAAGTGGCGGCAGGGCAACATGCG
CGTGATCACGGCGGTGTACCTGCATTGTCGGCCAGAGCTGCGCGACGAGTGGCTGGCCGGCAGCGACGTCGAGGGTGACG
TCGAGAGCTCGCTGCCGCTGGAACAGGCCCTGCGCAGCCTGACCCACTGGTTCAACGTGCGGCGGTATCCCGACAAGATG
GCGGCTGAGGTGCGCATGGCTCTTCGGGAAGAACACGACTTTTTTGTGCGGGAGCTGAAGCTGGACCTCAACTGGACCGA
GCTGGCCGAAGGGGAGAGCGTGATGGGCGAATGGGAAGGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62