GenePrediction:GLEAN_7825 Details

Name: GLEAN_7825
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2766376..2763274 (- strand)
Length: 3103
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2766376..2766078 (- strand)
Length: 299
Type: CDS
Source: GLEAN
Position: GCSC_113:2765982..2765729 (- strand)
Length: 254
Type: CDS
Source: GLEAN
Position: GCSC_113:2765648..2765140 (- strand)
Length: 509
Type: CDS
Source: GLEAN
Position: GCSC_113:2765075..2764859 (- strand)
Length: 217
Type: CDS
Source: GLEAN
Position: GCSC_113:2764790..2763274 (- strand)
Length: 1517
>GLEAN_7825 class=GenePrediction position=GCSC_113:2766376..2763274 (- strand)
ATGTCGGTCGCGAGCTCGGCCACCGCCTCTACTGCGAACCCAAGCGGTCAGCGAAAACGCCGCGGCAAGAAGAACAGCGA
GAAGAAAGATGGCTCGGCCAGCTTCACCACAACCGGTTCCGACGGCGCGTCTGTCGTTGCCACCAACGCTGCCGGCAAGG
TCATCAAGCGTCGTGCTGCCCGCGCCTGCGTCAGCTGCCGGAATCGCAAGGTTCGCTGCGACGTGGTCGAGACCTTTCCC
TGTGGCAACTGTCGCTGGGACAAGATCGAGTGTGTGGTCCAGGAGGGCCGAAGACGACGGTAAGCCGGCTCCCCTCTGTG
TGGCTGGCATGGCTGGCACAGCCGGCATAGCCACGTGGCCGACATGGCCGACTGACAACCGCAACGCGGATTAGGAGAGG
TCTCTTCAACGCACGTGAGACTGCAGGTGTCCTGCAGGGCGCCGATGCATTCCGTAGCCACAACCAAGAACACGGCCATG
ACCACGAACACGACCACGACCACAGCCATGGTTCTGTAAACGGCTCCATCAGCAGTGTTAGCGGCTTCGACTTCAGCAAC
GCCTTTGGTGGTGACGCCCCTCAGTCTTCTGTCGCCGCCTCGGGCAACTCCTTTGACACTCTCTCCGACAACAATCTTCC
CTTCCCCTGTAAGCAAGCTCCTCCTCTTCTCCACCGGCAACGGCCACATGGAAGCGAACAACCACTAACTGCCGTGAAGC
CGCCGCAGGTGTCAATCTGGGCAATGCTGCTTATGGTGGCAACGCTTTGTTGCTTCCAAAAACCTCATCGGCCCAACAAC
CATCCGCCGACCCTGCAGCTCCGTCTCTCAACCTGGCCGCCTTTCCGCTGCTGCCTCTCAACGGCCTCCTTGGCGACCCA
CAACAGCAGGCGTCCGCTCTGCTTCCCGGCTTCATCAGCCCGCTCCCGGGCAAAATGGCTCCGGAAGACGTCGTGTATTT
GCATAGCAAAGGCGCCTTTACTCTCCCAGACGAAACTCTGCAGAGGGCCCTTCTGCACGCCTATGTCGAGTTCGTCCATC
CATACATGCCGCTCCTGGAGCTCAACTCGTTCCTGCAGGTGGTTAGCAGCCGCGATGGCAGCAACGGCACCATCAGCCTC
CTGCTCTACCATGCCGTCATGTTCGCCGCTGCGTCCTTTGTGCCGGCTAAGTATCTCAAAGCGGTTGGCTTCAGCCGCCG
CCGCGAGGCGCGGAAGACCTTCTTCATGAAAGCAAGGGTAGGCACAAGCTTGCCATCAAAAGTACCGTTTCAAGTTACTG
ACACCCCTCCTTTCTGTCTAGGCCCTGTACGACTTCGATTATGAGACAGACCGTCTCACATTAGTCCAGGCGCTTCTTCT
CATGACGTACTGGTACGAGACGCCCGACGACCAGAAGGACACCTGGCACTGGATGGGCGTTGCCGTGTCTCTGGCGCACA
CTATCGGTCTCCACCGCGATCCTCGCACGACAGGCGAGCCGCTTCACCGCCAGCGTCTGCGAAAACTGAACTCTGGTGGT
GCTGTTTCATGCGGGACCGCATGATTGCGCTGGGAATGCGACGACCGAAGCGGATCCGAAGCGAAGATGCCGACGTGCCC
ATGCTCGCGCCGGTGGATTTCGAGAAGACCATACTGCCCGACAGCATCGACTCTGTCCCGACCGAGTGCCGCCTAGTGCG
CGACCTAGAGATGCAGGAGAAGCTGGCCGAGCTGTGCGTTGAGAAGGCGAAGCTCTGCGTCCTTGTCGGCAACATGCTGC
ACCAGCAGTACACCATCCTGCCTCGGGGCCGCCAGCGTTCGGCGGATTCAGCTGGTTCGAACAGCACCATGATGCTGTTC
CCGAATCGACCGGTCAACGAGGATGGCCAAGGCAACGGACCGAGCGTAGTGGACAAAATCGACGCCAAGCTGCGCGCCTG
GTTGCTGGCCCTGCCGCCGTCATGTCGCTATGCCGCTCTGACGCCGGCAGACGTGCAGAACGGCCGGGCCACCATCGCCG
TGCAGCGCACGCTTTTGCATCTTGTATACCACACGACCATGTCGGCACTACACCGGCCGCGGATACAGCCGGTGGGACCT
GGCTCGCCCATGCTGCCCATCGAGCAGCAGGAGTTTTCGCGGGCCCGCGTGCGCGACGCTGCCAACTGCGTCACCCGCAT
GGGTGGCGAGCTGTTGCGGCTTCGTCTAGAGTCGTATCTGCCGACCGCTGGCGTGACCGTCTTCCTGCCGGCCATGTTCG
CACACCTGCTCGATATTAAGGGTGGCGTGCCACGTGAACGTCGCCAGCAGGCCGTATATGGCTTCCTCACATGTATGCGG
ATCATGGAGAGCCTTCGTGAAACGTATGCGGCCGCCGAGATCGCCAAGGGTTTTGTCGAGTCACTCCTGAAAAAGGCCGG
CATCGATCTCTCCGCCGTCGTCAACTTTGGTGCTGACGGCGCGTACGGCATCAACAGCGGCCACAGCGGCAACAGCGGCA
ATAGCTGCATGTCCGCTGAGGATGGTACCGGCACACCCATCAATGGCACCTCCGTCTCCCTTCTTAACGCCACCTCCAAC
GTGGCAGTGCCGTACACTGAAGATGGTGTCGCCCACGCCGTCAGTGTATATGCTGCCACCACCCCCAAGGCAACAGCACA
CCCCATGACACCCGCTGATAACAATATCGCCAACGCTGATTCGTCACCGGCTTACCGAATGACACCTGCTGCCAAATCCG
CTTCCCGGGACGCGCAACAGAACTGTGCAGATGGTGGTATCTCAGCGACTGCTGCATCCAGCAGCTCGGCTGGCTCTGCT
GCCAGCTCGGATGTGGGAACTGCCAGCGCCTCCAGCACCAATCATATGTCCGTCAACGCCAGCATGACCGGTGTCGATGC
CAATAGCAGCAACGAACAGATGTGCGGCCTGACACCTTTGGCTGGCGCAGCGTCGGAAGATCCGTTCGAATGGGACGTCG
CGGTGGCAGACCCTAACAGCATGAAGCTGGACTTTGACCAGTGGCTGGACTTCCCCCCCGAGGGCATGGGCAGTAGTACG
GATCATGCTTTCTTATTTAACAACACATTTGGAAACGAGTCGATGCAACAGCCGGAATACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62