GenePrediction:GLEAN_7827 Details

Name: GLEAN_7827
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2755859..2753662 (- strand)
Length: 2198
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2755859..2755523 (- strand)
Length: 337
Type: CDS
Source: GLEAN
Position: GCSC_113:2755459..2755029 (- strand)
Length: 431
Type: CDS
Source: GLEAN
Position: GCSC_113:2754970..2754645 (- strand)
Length: 326
Type: CDS
Source: GLEAN
Position: GCSC_113:2754565..2753662 (- strand)
Length: 904
>GLEAN_7827 class=GenePrediction position=GCSC_113:2755859..2753662 (- strand)
ATGGTACCTATGGCTTCATATTCGTCAGCCGGCTCAGACGCCTCCACCCCACGCTCCTTGTCTCCCTCGTCGGCCGCTGC
GTCGACCCGCACCCACAGCACTATATCTAGCAAGCGCCTCTCGCTCTCGTCCACCCGTCGCATGTCCTCCCTGAACCCCA
TGTCATCCGTCGACATTTCTGCCATTCAAGAATCCCTTAAGATGGCCTCCCTCGACCACCACCGTGGCTACGTCCAGACC
AAGTACTGCGAAGTCAAGCAGGATCAGATGACTGAATACATTCCCGAAGACAAGGCCGGCGGCTACCAGGTGCTGCGCGA
GGCGCACTGGAACAAAGGTGAGCAGTGCATATAGTCTGTCTCTTTGCCCCCTGGCTCTGACCACTTCCCCTATCCCTTAG
GTCTCTCTTTCACACCGGAAGAGCGCCTGGCCAAGAACTTGACCGGCCTCGTCCCCCATACGATGGAGAGCATAGACATG
CAAGTCGAGCGTGCGCTCAAGATGATCCGGTCGCGGCCGACAGACGTGGACAAGTACCTGTACCTGTCCCACCTCAAGGG
CGAGAACGTCGACCTGTTCTATCGCGTGCTCATCGACAACGCCGGCGAGATGATGCCGCTCGTCTACACACCGACCATCG
GCGACGTCTGCTTGCAGTACTCCACCCTCTACACCCGCCCCGAGGCGCTCTACATCAACATCAAGCAGCGCAAGAGCATT
CGGACCATCCTGCGCAACTGGCCGTACCCGGATCCCGACATGTGTGTCGTCACTGACGGCTCGCGCATTCTCGGCCTCGG
CGATCTCGGTCTCAACGGTGTCGGCATTCCGGTATGCTCTGCTTCCCATCCATCATCTCTCTCTCTCCTCGTCACTAACA
CCGTCCTAGATCGGAAAGCTGGCTCTCTACACGGGCGCTGCAGGCATTCTGCCGCACAAGACGCTTCCCATCGTACTTGA
CTGTGGCACTGCCAACGAGGAAAACCTCAAGGACCCGCTGTACCTGGGCATGCGCTCCAAGCGTGTCCCCGTCTCGGAGC
AGGAGGAGTTCATGGACGAGTTCATGGAAGCTTGCGCCGACGTGTACCCGAACATGTTTGTGCAGTTTGAGGATTTCGAG
AGCGAAAAGGCATTCAAGTATCTTGCAAAGTACCGCGAAACATACCGGTGTTTCAACGACGACATCCAGGGCACAGGTGC
CGTGGTGCTGGCTGGGTAAGTGCGCTGTCCAGTGGGCTTACACGGATAAGTGGTCACGTGACATACACATGACAAAGCAG
CTAACTGGGGATAGGTACATGGGAGCCGTGGGCCTGTCTGGCGTGCCGATCGACGACCAGCGGCTTGTGTTCATGGGCGC
TGGATCGGCCGGTGTCGGTGTAGCCAAGCAGCTTGTGGAGTACTACGTGCGTCACGGTCTGACGGAGGAGGCTGCACGCG
ACAAGTTCTGGCTGGTGGACACCAAGGGCCTGGTGACCAGTGACCGTGGCGATCGGTTGGCAGAGCACAAGAAGTACTTT
GCGCGCACGGACAACCACGGACATCAGTTCAAGACGCTGGAGGAGGTGATTGAGTACGTCAAGCCGTCGGCGCTGGTGGG
CCTGACAGCCACGTACGGCATCTTCACCGAGTCGGCGGTGCGCGCGCTCAAGGCGTCGGTTGAGGCTGGCGGTGTGGGAC
GGCGGCCGATCCTGTTCCCGCTTAGCAACCCGCTGACGAAGGCGGAGTGCACGTTTGAGCAGGCGGTGGACTGGACGGAC
GGCACGGTGATCTTCGCATCGGGCTCGCCGTTTGCGCCATACACGACCAACGTGGCCAGCAACGGGACCAATGGGACCGA
TCAGACCGGCAGCGTGACGTACTACCCAAATCAGGGCAACAACGTGTACATCTTCCCGGGCCTGGGCCTGGGCGCGATCC
TGGCCAAGGCGAAGCGCATCACGGACGACATGGTGTACACGTCGGCAGACTCGCTGGCCCATTCGCTCAGCGCGGATGAG
GTGGAGCAGGGCCTGATCTACCCGCGCATTGAGCGGGTGCGTGAGGCCAGTCTGGTGGTGGCGCGCGAGGTCATGAAGGC
GGCCCGCCGCGACAACGTCAGCGCGCTGCCAGAAGAGCAGTGGATTGAGTGGGAGGAATGGGGCGATGTTGCGCTGGACA
AGTTCATCAAAGCGAGTGTGTATGATCCGCGCACATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62