GenePrediction:GLEAN_7828 Details

Name: GLEAN_7828
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2751198..2748316 (- strand)
Length: 2883
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2751198..2750686 (- strand)
Length: 513
Type: CDS
Source: GLEAN
Position: GCSC_113:2750067..2748475 (- strand)
Length: 1593
Type: CDS
Source: GLEAN
Position: GCSC_113:2748414..2748316 (- strand)
Length: 99
>GLEAN_7828 class=GenePrediction position=GCSC_113:2751198..2748316 (- strand)
ATGAGCGGGCAGACAGCCGACACGGCGACGACAGCGGCAACAGCAGCAGCCACGGCGTATCATGGCACGCCGCCGTGGAT
GCACCACGTCAGCGTGGCGGCGGCGGTGCTGGGCCCGATCGGGCTGCTGCTGCCGCCGCGACGGATGGGGGCGCGCAGCC
TGCTGCTGGCGGGCGGGGCCTTTTTTGCGTCGTCGCAGCTGACGTACGACTACACGGGCCAGTCGATCTGCCAGCGGTTC
CAGCGGCGAATGAGCGCGATGACGGACTCGGACCTGCCAGCGGCGGCGGTGCAGCGACAGGCGGCGATGCGGGCAGAGCG
AGAACGGCGGCGGCTGGCGACCGAGACAGCCGAGACAGCCGAAGCGGGCAGCGAGGCGCAGCCGGGCACGCTGCACAAGA
TCTGGATGGGCAGCGAGAAGGAGGACTGGACCCGGGAGCGGGCACGGCGCGAGAAGGAGGTGCTGGAAGCAGGCGGCGGA
TACTGGGAGCTGATCGTGGAACAGATCGGCGACGTGTGGACGGACCTGCGGAAGAAGGGCAAGACGGAAGAGGGAGAGGC
AGAAAAGGCGGAAAAGGAAGAGCGAAAGAGGTGAGGGAAGGGAAAGACCATGTTACGCTTCACGACTCCAACCAATATGA
GTACACTGCATCTCGTATCTGCTGCCATGTGTAGATCCTGGACTACAAAGGACGACGTAAGACATCACCGTATGCTTTGT
GGCTGATGCCGTCTAAAAGTAGAACAGCCAGCCTTCTTACGTAGTCCGTACCTGAGCCTAAGGCGGTGCCTGTGGCTATC
GCTCGTTAGCGTCCTGACCAGACAGCTGCTAGCGTGCACTGCCCTGAACGTTGGCCAAGCCCCATCGTGCACAAGCACTC
TGCTCCATATTATAGTGTGCGTGTCTTCTCATTTCTTCTTCATTTCTCCCCCATCATCTTATGCAGCACGCCCGTTTCAT
TTGGCTGTCTTGGATTTTCATCTTGTTTGACGACGGAAGACGGAAAGGGAAGACGACGAAACGAAGACGAAACGAAGACG
AAGACGAAGACGAAAGAGACAAGAGAAAGCGACGAAACGACAAAGACGAAGCGAGCGGACGAGACCAACCGAGAACAGCC
CCCATCGACAGGGGCCGCGGAAGCAAGCAAGCCAGCCCTGCCATTTCCCAGCATCTCGCTTGGCCATGTCCCGTTCCTAC
GCCGACAACTACGTGTCCGGGGCCCTTCCACTGCCACCGTACCAGCGCGACAACAACAGCGCGCAGCGGCCGTCACAGCA
GCAGTGGCACCAGTCGTCATCGGCCGACAGCTACTCGGGCACGACGGTGGTGGGTGGCAGCAGCACGCCGGTCGGAGCGA
GCACGTCCAACCTGTCGCCGTTTGACACCGTCTTTGACGACCACATGTATCCGGCCGGGACATACCAGCAGCAGCAGTCG
CTGCCAGGCCAGCAGCAGCAGCACGAGCCGGACACGGCGTATTACGGAGCACGGCGGACACCGTCGCAGGAAAACATGCT
GCAGGCCGTGGACGGGATTCCACTGCGTGATCGAGGGGGCGGCGGCATGGACTCGCCGGACCATGTGTACGACATTCCAC
AGGGCGGAACGAGCAAACACAAGCAGCAGCAGCAGCAGCAGACGAGCAAGGGACCGGTGCGATTTGGCGAGCTGGGCATG
TTTGGAGCGTCACGGCGACGGATTCCGTACGTGGTCTACCTCCTGACGACGGTGCAGGTGGCCGTGTTTATTGCCGAGAT
TGTGCGCAACGGGATCCTGACCGGGTCACCGATCATGATCCACCCGTCGTTCAACGTGATGATCGGGCCATCGACATACG
TGATGATCAACATGGGCTCGCGCTTTGTGCCGTGCATGCACAACGTGGCGGGTGTGCAGTCGGCGACCGAGACGATCAGC
TGGCCGTGTCCCAACACGACAACGTCCGACGCGCTCTGCACGCTCTCGCAGCTGTGCGGCTTTGGCGGCGTGCCCGAGCC
GGCGTACGACGGCAATGCCGACCAGTCGCCCCAGCCGGACCAGTGGTTCCGCTTCATCGTGCCCATGTTCATGCACGCCG
GCCTGATCCACATCGGCTTCAACATGATGCTGCAGCTGACCATGGGCCGCGACATGGAGCGCGCCATCGGTTCCATCCGC
TTCTTCATCGTCTACATCTGTTCCGGCATCTTTGGCTTTGTGCTCGGCGGCAACTACGCCGCCACCGGCATCTCGTCCAC
CGGCGCGTCCGGCGCGCTCTTTGGCGTCATCGCCCTCACCCTGCTCGACCTGCTGTATTCGTGGCGCGATCGGCGCAACC
CGGTCAAGGATCTCATGTTCATCTTTCTCGATGTCCTCATCTCCTTTGTGCTCGGCCTGCTGCCCGGCCTCGACAACTTC
TCCCACATTGGCGGCTTCTTCATGGGCCTCGCCCTCGGCGTCTCCGTCCTGCACTCGCCCAACGCCCTGCGCCGTCGCGT
CGGCGAGGAGAACGCCACCTACGCCGCCGTCAATGCCACCTACACGTCGCCCACCGCCTCTGGCGTCGCCGCCTTTGTGC
GCAACCCGCTGGCTACCTTCCGCAACCGCCGCCCGCTGTGGTGGGCCTGGTGGCTGCTGCGCGTCGGCTTTGTCGTTCTC
GTCATCGTCCTCTTCGTCCTGCTGCTCAAGAACTTTTACGTCTACCGCAAGACGTGTGGCTGGTGCAAGTACCTCAGCTG
TCTGGTGAGTGGGTGTTGGGAGACTGGTTTTATGCATAGGCAACGATCCATGCTAACAATATAGCCCGTGCACAACTGGT
GCAACATTGGCAATCTGCAGCTGACCAACACGACGACAAAGCGCGACGTCTTGGGGCTCTCCCGGTTCGCAACGTTTGTC
TGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62