GenePrediction:GLEAN_7829 Details

Name: GLEAN_7829
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2740147..2738582 (- strand)
Length: 1566
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2740147..2739352 (- strand)
Length: 796
Type: CDS
Source: GLEAN
Position: GCSC_113:2739295..2739181 (- strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_113:2739120..2739006 (- strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_113:2738944..2738816 (- strand)
Length: 129
Type: CDS
Source: GLEAN
Position: GCSC_113:2738749..2738582 (- strand)
Length: 168
>GLEAN_7829 class=GenePrediction position=GCSC_113:2740147..2738582 (- strand)
ATGGAGTGGTTTGGACGGGCCAGCATCGAGTTTACGCACTCGGCGACGCCGTTGCAGCTGACGCGCAAGAGCAAGGACAA
GGATGGCGACGGCGACGGCGACATGATCGACCTGCCGCAGCTGTGTCGCGACAGCACGCCGCCGTGCCAGCTGAACCCGC
TGCTGTTCAACGGCCACCTGCAGACGTTCTGGACGGCTGTCGGGAACGCGGCACCGCACGTCTACTATCGGCGGCGGGTA
TTTGAGTCAACGCACGCCCTGTACGGCGGTTCCTTTGCCGTCGACTTTGCCGTGGCGCCGCACGAGGACGAGGATGCGGT
GCTGCCGCCGCGGACAGCGCCTTTCGACGAGGCTGCTTTTGCCGACATCGGCTCCGACGACTGCCGACCCATGCTGCTCG
TGCTGCACGGCCTCTCGGGTGGCTCGTACGAGGTGTATCTGCGCCACTGCATTGCGCCACTGCTCGCCGACGGCCGCGAC
TGGGCCGTCGCCGTCATCAATGCGCGCGGCTGTGCTAACAGTACCCTTACTAGCGGTATGCTCTTCAATGCCCGCGCCAC
CTGGGACGTCCGCCAGGTCGCCCGCTGGGCCCGCCAGACGTTTCCGAACCGGCCGCTCTTTGGGCTCGGCTTCTCGCTGG
GCGCCAACATCCTGACCAACTACGTCGGCGAGGAGGGCGTCGACTGCCCGCTGACGGCCGCCGTCGCCGTCGGCAACCCG
TTCGACCTGCAGCTCTCCAACAAGGCGCTCCAGCGGACGTTTGTCGGCAAGCACGTCTACGAGTCCGTCATGGCAGGTAT
GTCGCGCGACAGACCGTACTCGGCAGGCAGGCCGGCTGACGCAGAACCGCAGGAAACCTCAAGGCGCTCATCTCCAAGCA
CAGAGACGTTCTCGAGAAGACCACCGACCTGAACTTTGACCGCATCATGGCCGGGAACACCCTCTACGAGTTCGACCGGG
AGGTCCAGTGAGTCATGCTGTCCCGTCTCGCACAGTCTGGTATCCGCTGACAGCAGCCGCCGCAAAGATGCACTACCTGG
GGCTATCCGACCGAAGACGCCTACTATCGCGATGCTTCTTCGTCAGACTCGGTCACGGCCATCCGCATCCCCTTCCTGGT
CATTCAGGCCAAGGACGACCCGGTAGGTCATAGCTCCTTTGACCTGTCTGTTCGCCTGCCTCGGCACTCTTCTGACTGAT
TAGATCGCCCCCGAAGAAGCGGTGCCGTACGGGGAGCTGAAGCTCAATCCCTATACCGTCCTCTGCATGACTTCGCTCGG
CGGCCACCTGTCCTGGTTCGAGCCGATGGGCGGCCGCTGGCACGCAAAGCCGGTAGGTTCCCCAGCTGACCGGTAGCCGG
CCTCGCTCGGCCTCGACTCGCATGCTGACTGTGCACAGGTGTCCAACTTTCTGCACAAATTCGCTACAGAGATCGATCTG
GACGCGATTCCGCCGCGACCAAAGGATCTCAACACGACGACACCGAAGAAAGGCGGTCCCAAGGGAGGGCCGTTCGACCC
CATGCGGAGACGGATGCAGGCTCACCATGATTCATACATTGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62