GenePrediction:GLEAN_7830 Details

Name: GLEAN_7830
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2737217..2735695 (- strand)
Length: 1523
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2737217..2736917 (- strand)
Length: 301
Type: CDS
Source: GLEAN
Position: GCSC_113:2736865..2736461 (- strand)
Length: 405
Type: CDS
Source: GLEAN
Position: GCSC_113:2736328..2735914 (- strand)
Length: 415
Type: CDS
Source: GLEAN
Position: GCSC_113:2735845..2735695 (- strand)
Length: 151
>GLEAN_7830 class=GenePrediction position=GCSC_113:2737217..2735695 (- strand)
ATGGCACAAGCAAGCACGGCAAGCGTCCCTCGGTGGGCGGCCCTGGCGCGCGACACCAACGAGACGTCGATCCAGCTGGC
CCTGAACCTCGACGGCGGCGCCTTTCCGCCCGACACGGACCAGCGCCTGCTGGATCTTGTGGCGGGCAAGGACGGCCAGA
AGGGCGGCCATGCGGTGCAGGCGAGCAGGTCGCAGACCATCAGCATACACACGGGCATCGGCTTCCTGGACCACATGCTG
CACGCGCTGTCGAAGCACGCCGGCTGGAGTCTCGTCATTGCCTGCAAGGGCGATCTGCACAGTGAGTTGGGACTTTCAAT
TGCTTGATCGAACACTGCTCACGCGCTTCCAGTCGACGATCATCACAGCGCCGAGGACGTGTGTCTGGCGCTCGGCTATG
CCTTCCACCAGGCGCTGGGCACGGCCACCGGCATTGCCCGCTTCGGGTCGGCCTATGCGCCGCTGGACGAGGCGCTGTCC
CGTGCCGTGGTCGACATCTCGAACCGGCCGTACGCCGTGATCGAGCTGGGCCTGAAGCGCGAGAAGATTGGCGACCTCAG
CTGTGAGATGATCCCACACTGCATGGAAAGCTTTGCGCAGGCCGCGCGGATCACGCTGCACGTCGACTGCCTCCGCGGCT
TCAACGACCACCACCGGTCCGAGAGCGCGTTCAAGGCGCTGGCCGTGGCCATGCGGCAGGCCACCAGCAAGGTGGCCGGC
AAGGAGGGCGAGGTGCCCAGCACAAAGGGGACGCTGAGTGTGTAGATGGGCCTGCGGTGAGACGAGACACTAGTTGTATG
AATTTAGTCAAAAAGAAAAGATTTCTTGGTCAAACAGAGGTCGAGCAGAGTGAAGTTGTAGTGGAACAAAGACGGTAACA
GTCGAAAAGTACTCCGTACCGTGCAAAGTACTGCTGAAATATGCGCCTGCTGCAAGCTGCAGATACAGTGGAGCCTCAAG
CGGAAGCCCCGCTCAAAAGTCCATCCAGCCACACAGCTTCAGCAACTCAGTACGACTGCCAACATCACGCGACCCGGCGC
AGACGAGCATCTCGGCATCCAGACTTCCTGCCGCACTCGACTTCTTCATCGCCGTGACCGCCGGACTGCTCTCATCTCCG
GCGCCCCATCCACCATGCGCACCCATGATACCGTGCGCGACGAGGAGGCCGCTGAGGCCGCCTGGGAAGCCATGCACGGC
GCCGGCTACGGCATGGTCAAGTACGGCGCCGCCATGGGCGTCCTGGCCGGTTTCGGGCACGCGCTGTCGCCCATCTACCG
GGGGCTGACGATCCAGTTCAAGGTGTACGCAGGAGTGTGGCTGCGGCCCTGTCGAAGCTGACTAAGCTGACGATTTGGAT
TCTTCTCTGCAGATACCTCCAAATGTCCGGCATGGTCCTGGGTGCTATGCTCGAGGCCGAACATCGCATGAGGCTGTTCG
AAGCTCGCATGCGGCTTCAGCGACGGATGCAGCGCCAGCAGGCCCGGTTGCGGGCTCTCGAGGAGGAGCTGGATGACGAC
TGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62