GenePrediction:GLEAN_7831 Details

Name: GLEAN_7831
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2733994..2732893 (- strand)
Length: 1102
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2733994..2733966 (- strand)
Length: 29
Type: CDS
Source: GLEAN
Position: GCSC_113:2733904..2732893 (- strand)
Length: 1012
>GLEAN_7831 class=GenePrediction position=GCSC_113:2733994..2732893 (- strand)
ATGGACATTGCTATGAGGAACGCCCAGCCGTGAGTTGTCCGAGGATCTGTTCTCTGCAGCTGGTCGTTTATGCTGATGTG
CATGCCCCAGGATCCGCCGCCAGGACCTCTACCACGACGGCGACTCGTCGGTCGACAATGAAGGTTTTTCGGGTGCGGGA
GCTGTTGGCGGTGATGCTGCTGCGGCAGCTCGTGCTGCTCTGGAGGCGATCATGGCGCGCACGCTCGGGCTAGACTTTGG
CTTGCTCACGACGCCGGCAGCAGCCACGCCGCCCGAAGCCGAGAGTCCCGACGAGAGCGGAGATGTGGCCATGGAGGAGA
CGTCGAAAGAGGCAGAGAAACCAGCTTCAGCGGCCGACGGCGGCGTCGAATTCGCCTTCCGGCTGTTTTCGTCGAGCGGG
AAAGCGGCGGCCGTGTCGGAGCCGGCCGTCCCGACAGTGGTTCTCTACGACGATATCGTCCTCACGGGCGACGGTCTCGA
TACTGCGACTGGGCCCGGCGGCCTGGCCAGCGCGCCGCGGCCGCTGAGCGCCTACGTGGCCAGCGAGCCGACGGCAGCCG
AGCTCGCGCGCTACGCCCAGACGGCCGTCACGGGCGAGACCATCGCAGCCCAGGCGGCAGCCGGACAGCGCAACGCGTGG
GGGCTGGAGGTACCGTGGCGGGCGCGCACGACCGTGCGGGTGTCCCAGAGCGAGCTGCGCGCGCTGCTGGCCAGCGCGCT
GCCGGACGAGACGAAAACGCCCCTGCCACAGCTGGCCGCACAGGCCGCCAACAAGCTGCCTCCATGGGCCCTGTTGTCCA
CATCATCCGTGGCTTCATCATCGATCCCACTTGCCGAATGTGTGGCCTCGCGCAAGCGACGCCCCGGAAAGAAGCGCCGG
ATCGTGCTGCGACAGCGCGAAAAGGCGCGGCTCGAGAAGGAGGCGGTAGCTAAGCTGCAGCACAAGTCCAAGGAAGAACA
CCTGCTGGAGAAGAAAAAACGGCTTAACCGGCTCAAGAAGCTGCGGCGGCGCGAGAAAAAGCGGGAGGAGCACAAGGCGG
GCGGCAGCCAGGGCGCCGACGACGGCAACAATTCCGACAACTCCGACGGTACAGACACATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62