GenePrediction:GLEAN_7832 Details

Name: GLEAN_7832
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2721494..2717455 (- strand)
Length: 4040
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2721494..2718523 (- strand)
Length: 2972
Type: CDS
Source: GLEAN
Position: GCSC_113:2718460..2717455 (- strand)
Length: 1006
>GLEAN_7832 class=GenePrediction position=GCSC_113:2721494..2717455 (- strand)
ATGGATGCCGCCGACGAAGATGCAGACGTCCGTCTGCAGAAAGTATCCAATGACCTGCTGAGCGAATTCGACGGAGCGCT
GGGCTCGTTCCTGCGGCGCCCAGGCAGCAAGAAGACAGAGACAGACAGCACGCTCCGGACCCATGTGCGTGCCCGCGAGG
CGTACCATCTGATTGGGCTGATTGACCAGTTCCAAGAGCTGCCACAGCTCCTGGACGGCTATCTCGCCCGATGGCTGCCG
GAGCTGGCGGATGCATTCCTGGGATGCGTGGCACAGGCACCAAAGGCACAGGCGCCGCTGTCGTCGTCGTCGCCGACGTC
GCTGGTCATGTCGCTTCAGGCGGCCGTGGCTCGGCTGCTGTACACGTTTTGCAAGGTGCGTGGAGAGAAGGTGGTGGTCG
GGTTTTTGCCGGTGGAGACGCGGTACCTGGAGCGTCTGCTGGGGGCGCTGGAAGCGCAGGAGAGGCGCGGCGGCGAGGAC
GGCGAGGGCCGGTGGACGTGGGAGGAGCGGTACGTGGTGCTGCTTTGGTTGGCACAGCTCTTCCTGGCTCCCTTTGATCT
CTCAACGATCTCGACTGGGCGGGCTGGCGACGAAGAGGGCGACGAGTCGGCGACGATCGAAGGGTTCGTCTGGCCGAGCG
GTGATCAAGGCAATGGCAACAGCAACAGCAGCCGTTTACTGCCCTCCATTACCGTTCGTGTACTCCCTCTGGCGATCGGC
TACCTGGCAGCTCCGGGAAAGGAGCAGGATGCTGCCCGGGCGTTGCTTGTGCGGGTAGCCATGCGACGGGACATGCAGGA
GCTCGGGGTGCGTCATGCTCTGATCCTATGGGCGCTGCACTCTCTACGACCGCTGGGCGCACAGATGCAGACACCGACTT
CCAGGCGGCCCTCTTACTACTACATTGGCACGCTCTCATTTCTGGCCGGCATCCTGTCGGCTGCGGCGGGTGCCTCGGAC
ATGGACGACGCGCTGGCGTCCATCTTTGCAGCGGTGCACGCGGTGGCCGAGTCCGAGGGACAGGATGCGGACGTGTCTCT
GCGGGATGATGCGGTCTTTGTGGCGATCCGGTCATCGGCACTGGCACGCAAGATGATGATCAAGGCGGTGCGAGCGATTG
CGGTGCGGTACATCCAGTTGGCAGCAGCCGGCCAAGCGGGCGAGGGCGAGGGCGACGCGATCATCGAGACGACCATCGGT
TATCTGCTGGACCGGCTAGCAGATAACGACACGCCAGTGCGGTTTGCAGCGAGCAAGGCGTTGAGCGTGATTGCGCTGCA
GCTGGACGCGGACATGGCGGCACAGGTGATCGACGCAGTTTTGGAGGGTCTGGAGCGCAACGTGCTAAGGCTTCCGGGGT
CAATTTCGGGCTCAGGCTCTGGCGGCCGCGACCTGACGGCAGTTGATCCGTTGGAGTGGCACGGGCTGATGTTGACGTTG
GCACACCTGCTGTACCGACGATCACCACCGCTGGCAGTCCTGCCGGCCATCGTGGCGTCGCTGCAGGTCGGACTGGCCTT
TGAGCGGCGCAGCGTCTCGGGCAGCGCCACGGGGACCAACGTGCGCGACGCCGCCTGTTTTGGAGTTTGGGCGCTGGCCC
GCCGCTACACCACGGCCGAGCTGCAGCCGCTGGCAGTGTTGCAGCCACTGGCCACCGACCTCGTCGTGGCTGCCTGTCTG
GACCCGGCTGGCAACATTCGCCGCGGCAGCTCGGCCGCCCTGCAGGAGCTCGTTGGCCGTCATCCCGACACTGTCTGCGC
CGGTATCGCTCTCGTCCTGGCCGTCGATTATCACGCCGTTGCTCTGCGCAGCCGTGCCGTTGCCGATGTCGCCTTGCAGG
CCGCTGCCCTCGCCCGCGACCCCTACGGCAGCGCCCTGCGCGACGAGCTGCTCGGCTGGCGCGGTGTCGGTGACGCTGGC
GATGCGGCTGCTCGACGCGGTGCGGCCACCGCCTTTGGTCACATTGCTCAGCGGCTCGCCGCTGATGGACCTACTCTCTG
CAACTTCCTTGGGACGGCCAGTATGCTCACCGAACGCATCACCAAGCTGCAGCCTCGCCAGGTGGAGGAGCGTCACGGCC
TGCTGCTCGCGCTCGCTGCCGTCCTGGACACGTTTCCCGCTCTGGTTCAGGCTGCACAGACGCTGGTCGAACTCCCCGGC
GTGTGTCAGAAAACAATTTGCTTGTTGCACCGGGCTCTGCAGAGCTGCAAGATTCTGGCGCTGGCTACTACAACCAGACG
GCTCGAACTGCTGGCCGAGGCCTCCAGCCGGCTGATTGTCTCGTCCTTTCCGGTGTTGCAAGCCACCAGCACAAACGACG
GCAACAAAGAAACGAAGGCAGCTCTCATATCTGGTCCTGAGCTCGTCTCCGAGGCCAACCATGTGCCTGCAACCGCGTTC
GGCCAGGTGGTGCAAGCTCTGACTGGCACTCTCGCCCCACAGGACGACATCCGTACCGTTACAGATCTGGCTGCATCGCT
GCTTTCCGACGTCTGGCTAGCCCGACGGGAGCCCGAGGTGGTTGATGCCGCATCAGACGCGGCTCTGATCCTGCTGGTGG
TCTTGTTCTCGACCGCAGCCCGTCACGAGCTCGTCTGTTCGTGGGCCGCCACCGTCCGACAGCCGGCGGCTACTCTGACG
TCCAAGACAGCCGCGGCCCGGTCGACAAGCCGAGGAAGCAGCGGGTCGGGCTTCGTCTTCGCCTTGACCAAGGCGTACCC
GCTGGTGGCACTCGGCGACACCAGTGACGAGGACCCTATCAGCCGTGCCATCCTCGACCGCTGGGCCTCGGACAGGTCGA
TCGAGGCACGCGTGTCCCTGCTACAAGCACTGGCCCAGAGCCCGGCAGTGCTGATGATGACAGCGCCAGCACCAGCGACA
GCGACAGCCAACCCCGGACGGTTCCGCACCATCTTGGCCGCCGGCCTGGACGACTACACGACGGATGCGCGCGCGGCGAC
GTCGGGTCGCACGTGCGGCTGCAGGCGTTGCGAGCAACACAGGCGCTCTGGGGCCAGGAGCTGGTGGCCGACAGCGGGAC
AGCAGCCTCGGGATCGCTCCTCTTCCTGCGCGTCCTCCGGCTGGCGGCCGAGAAGCTCGACCGGGTGCGCACCGCGGCCC
AGCCGACGCTGGCACTGGCTCTGGGCGAGCCGGCAAGCAGCCGGCTGCTGTCGCTGACGTTCTCGTCGCAGGCCTACTTC
CGCACTCTGCTGGGGCTGTGGGACGAGGCAGAGGCCGGCAGCCTGGGACCCATTGCAACAGCAGCAGCAGCGGGCAAGAC
GGGCGACACAGCTGCAGCCGTGCAGTGGATGGCAGCCCTGATGCGCGGCTACGTCACGTCGGCCGACACGGGCAACGAGG
AGCTGGTGATTGCCAGCCGGGCAGCGTTGGTAGACTACGTGGGCCAGGGAGATGCGGCGGCGACGCGGCGGAAGAGACGG
CTGATATGGCTGTCCCTGCTGCGGAATCTGCCTGGAGGAACGACGACGACGACGACGACGACGACAACGGGGAAGCCCAA
GGTCCCGGTGCCGCCCGACCGCATCGTGGTGCCGACGCTCGAGATCGTGGCCTTTCTCTTCTACAGCGGTGTCTTTGGCC
GGTCTGTCGGCGAGGATGACAGCGACAGTCATTTGGCAGCGCTCTGCCGACAGGTGTACCTGGCGGCTGAAAAGGCGGGC
AGCGTGCGCAAGCTGGAGGCGTGCATCAAGGTGTACGGGGCCGTGGCTGCGGTGACTGCAGAGACTGCAGATTCGGCCGG
CCCAGTCGCCCGACAGAGGCTGGCGGCCCTTCTCCGCCATCCGTGGCCACGCATCCGAAATGCCGTCGTTGATGAGCTGT
GGGGTCTTGGACTGGGATTGGAGCTGGGGCTGAGGCTGGAGCGCAGCCCAAGCGAAAACGAGGACCGAGGGGGGGGGCTG
GTTGCGGCTCAGAATGCCCAGTTGGGGCAGTTCGACGCGCTGAAAGGCACCGACTGGGGCTCGGCCGAGGCAGAGGCAGT
GGACGCGCTCGTCGGCCGGCTGGGTCTGGGGATCAAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62