GenePrediction:GLEAN_7834 Details

Name: GLEAN_7834
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2711599..2709047 (- strand)
Length: 2553
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2711599..2711441 (- strand)
Length: 159
Type: CDS
Source: GLEAN
Position: GCSC_113:2711382..2710544 (- strand)
Length: 839
Type: CDS
Source: GLEAN
Position: GCSC_113:2710122..2710052 (- strand)
Length: 71
Type: CDS
Source: GLEAN
Position: GCSC_113:2709984..2709047 (- strand)
Length: 938
>GLEAN_7834 class=GenePrediction position=GCSC_113:2711599..2709047 (- strand)
ATGGCGTTCACGATGCACTCGCACTCGGGGCAGTTCTGCGGCCATGCAGTCGATCGGCTGGAGGAGGTAGTGCAGCAAGC
CATTGTGCTGGGCTTCCGCACGCTCGGCATGAGCGAGCACATGCCGCGAGTACACGTGGAGGATCTGTATCCGGAAGAGG
TGTGTCTGGTCATCTCTGGTGCTGCTCCGTCGTCTTGCACTCGCTCACACGGAACAGAAAGGCGAGGACCTGCAGGCGTC
TCTGGTAGCGCTGGACCGGCTCTTTGAGGACTACGTATGCGAGGCGCTGCGTCTGCGCGAGGCGTACGCGGACCGGATCA
CGATCCTGGTCGGCTTTGAGGCAGAGTGGATCCACGGGGCAGCGGACGACGGGGTGCGCGTGCAGGCGCTGGCGGCGCGG
CCGGAGCTGGACTACTTTGTAGGGTCAGTGCACCACGTCGGGGCAGACGGCGTGCCGATCGACTACGACAAGGCGTCGTA
TGCGCGGGCCGTCAAGACGAGTCAGCAAAAGGCGCTGTCTGTGGATAGCCTCTCGGCCGAGGTCAAGGCGAAGGTCGTAG
CCGATCCCGAGGCCGCCCTCTACCTGGACTACTACGACCAGCAGCTGGCGATGCTACAGGCGCTGCGGCCACGCGTGGTC
GGGCACTTTGACCTCGTGCGGCTGCTCAGCGCCGATCCGGCGCGCGACTGCCGTGCGGCCTGGGGCGGCGCCGTGTGGCC
GGCGATCGAGCGCAATCTGCGGGCGGTGGCGGCGGCTGGCGGCTGGCTCGAGTGCAACACGTCGGCGCTGCGCAAGGGCC
TGGAAGAGCCGTACCCGGCGCGGCCCATCGCTGAGGCCTGGCTGCGCATGGGCGGTCGCTTCACCATGTCGGACGACAGC
CACGGCATTGGTCACGTGGCCACCAACTATCGGCGCGGCTTGGCCTACCTCGCCAGCCTGGGCGTGACAGAGGTTTGGAC
GCTGGCGCGGGTCGCGTCCGGCGGCGGGCTCGTGGAGAAGAGCGTGTCGCTGAACGAGTTCGCGGCCAGTCTGAAGGTGC
CGGAAGAAGTCGAGAAGTAATGGGGGCCAGAATGCGAGGCTGAAGTGGAGAAGAGTAGATGCAGACAGAAATCATTCCGA
CAGTGGGTGCTATGCGTTAGGACTCTGCAAAGCTAGCAATGCTCTGTTATAAATTCGCTTTACGGGACTAAGCCTACAGA
GTACGGAGTACTACGATGTCATATTGACAAAAATGAAATTTGTCTGGAATTTTATCAAGTCAGACTTGGCAGTAACTTGC
TAGATCTACGAAGTATAATTCTGGCAGTCGCTGCCCCACCTCAGATCAACACGTGATCCGACGCATTTGGACAATGTGGG
GTTAGCCCAAAGGCGGGGGTGCTAACGAAAAGCTTCTTGTATGGAACTCTTGCCCGTACAATACTGACTGCTTTCATTCG
TGACAAAACAAATAAAACCCGACTTATATTGAACCAGAACGATGGCAGACTCGACGGCAGCAGAAGTGCTGGTCCCCAAG
TTTCAATACGAGCGGACGCTGAACCAAGGTGAGAAGCGAGCCTGCTGTTCACAGCAGCATTGCCGCGTCGTATGCCAGGA
CTAACCCGCATGCAGACCAGGCCGGTCGCCGTACGACTTTGTACGGTGCTATAGACGGGCAGCCGGCACTTCTGACGCTG
GAGCGGGCGCCATTTCCGACCGCGCCCGAGTACCTAGGGTCTGTGGCCGGCAGCCTGGGCTGGCTCAAGAACCTGGGCGC
CAACGACGTCTACTTTTGGTATCTGGCGGGGGAGAGAGCGCCTGAGGAGGCAACAGAGACAGCAGGAGAAACAGGGACAG
CTGCGGCCTCGTTCGGCGCCGCCACCCCCTCGCTCAAGATTAATCTCATCTGGCCCTGCACGGCACAGCACGTGAAAAAG
TACAGCCGACAGGGCGTGCGACTGGTGACGGAGACGGCGGCGCTGTACCGCGACCGCGTGCGGCCGTTTGTGCAGGCGCA
GCGCGACGCCGGCCGGCTCGGCTGGGTCTTCAACATCATCGAGGGTCGTCGTGAGGCTGAGGACGTGATCTATCGCACGC
CCTACGGGGCCCAGCCGCTCGAGGGCTTCCTGCTGCTGCCCGACCTCAACTGGGACCGCCGCACGGTCGAGGCCCTGCAT
CTGCTCGCCATCGTCGAGCGCCGCGATCTCTGGAGCCTGCGCGACCTGCGCAAGCACCACGTGCCCTGGCTGCGCCGCAT
GCGTGCCTGCCTGGTGGATGCCGCCGTCGGCGTCTACGCCGGCCTCGAGCCCGACCAGCTCAAGCTCTATGTCCACTACC
AGCCGACTTACTACCATTTTCACATCCACATCGTCCACGTCCAGCTCGAGGCCGGCGCCACCCAGGCCCTTGGCAAGGCT
ATCAGCCTCAACAGTATCATCGAGCAGCTCGACCATATGGCCGGTGGCCCCGACGCCGGCATGGACGCCCTCACGCTGAC
CTACACCCTCGGCGAGGCCAGCGAACTCTGGACCACCGTCTTCGGGCCGCTCAAGGCAGAGAGCCCAGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62