GenePrediction:GLEAN_7835 Details

Name: GLEAN_7835
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2707020..2705277 (- strand)
Length: 1744
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2707020..2706815 (- strand)
Length: 206
Type: CDS
Source: GLEAN
Position: GCSC_113:2706753..2706736 (- strand)
Length: 18
Type: CDS
Source: GLEAN
Position: GCSC_113:2706654..2705277 (- strand)
Length: 1378
>GLEAN_7835 class=GenePrediction position=GCSC_113:2707020..2705277 (- strand)
ATGGCTGGCTCACTGCTACAGAACCCCAGCCCTTCTCTGGACACCTTTCTACAGCCACTTCGCGTCGATGGAGACCGCGT
CTTCGCCTTGTCTCGCGGCTTTGCCTCCACTTTCGCTCACCTTGCTGCCGATTCTCTGGACCAATTCCTGTCAACGCCCA
TAACCGAGTCCATACTACTGCCGCCTAGAAAACGACAGCAGGGCACGTGAGTACTTGCCATTTCTATACCGGCTACTGCT
AAGCCCTATCTGTACTGACCAGTGCAGATATCTTGCCATTGACATGTAAGCAGGCAATTTCCCGTCTATCTGGAGAGGTA
TCTCCCGCATACGGTCTGGGATCTAACTTTTGTGGCGGGGAAACAGTGGCGGAACAAATTTGCGGGTAGGCTTCATCGAG
CTGGGTGGCGGTCAGACTCTCTCCCATGATGGCGAGCTAGCATCAGATGGACCAAGTTCGCCAGCGTTGCGGCGGCTGCA
CGAACGAAACTGGCCCATCCAGGAACACCTCAAGAGCCAAAATGCCGACAGCCTCTTCAAGTGGATCGGCGGCTGCATTG
CGGCAGTTGTGCGCGACGGGACTGCAAGCTTCGGCCTGCCGGCAGACGAAGCATTGCCGATGGGGGTCACCTTCAGCTTT
CCCATGGAGCAGGAGTCGCTGTCTGAGGCCAAGCTGATGGCCATGGGCAAGGGATTTGCCATGACGCCCAAGCTCGACCT
GGGTTCGCATCTGATCCGAGGGTACGAGATAGCCCAAGCAGAAAGTGCTGCGAAAGACAGTTGCTCGCTAGTCCTGCCCC
CCATCACCGTTGCTGCCATCACCAACGATGCTGTAGCGACGCTGGTTTCCTTTGTCTACGAGGTCCAGGCACGTCGGGCG
CAAGGCAACCAGAAGGCGGCCATGGGCCTCATCTGCGGAACGGGCAGCAACGCGACGCTCCTGCTAAAGCGCAGCCTGCT
GCACCCGTCCAAATTGCCCGAGAGGGTAAACGGGGACGACGACATGAGGATCGCCGTCAACACCGAGTGGAGCATCAACG
GATCGGAGGGCGCGATGAGGGCCGTGGGCTTTGTGAGCCGCTGGGACGACCAGCTGAGCCAGACGGTCGAGGCGCCAGGT
TTCCAGCCGCTGGAGTACATGACGGCCGGTCGCTACCTGGGCGAGCTGGGTCGCATCATGCTGGTGGACTACGTAACGAG
CGTTCTGGGGTTGCCAGAGGACGCGCTGCCGGCAAAGTTCCTGCGGCGCTTCGATCCTCGCAAGACGACCTTTCTGAGCC
ACTACCGGCCGGGGAAGCGGCAGTCGCTGCTGGCGATGCTGGAGGCCGAGTTTCCGGTCGAGGAGCTGCCGAGCGGACGC
CCGCCATTCCAGTGGACTGGCGAGATCGCCGCGGCACTCTACCACATTGCCAAGGCCATCGAGACGCGGGCCGCAGCTGT
CATCGCCGCGGCCACGATCGGCCTGCTCGACTGTGCCGGAGAATTGCCGGCCGCGTCGTCGGGATCGGCACCGCTCGAGC
TGGTCGTTGGCTACACCGGAGGTTGCATCACCAACTTCCAGGACTACCTGGTCGACTGCCAGGCCTTTCTCGACGACATT
GTGGCCCAGCGATACAGCAGCCAGCTGCCAGCGCCGCCTTCGGTGCGAGTGGTCTTGAGTCCCTGTCATGACGGAGGCAT
TAAGGGTGCCGGGATACTTGTGCCTGCCTCGCTGGCAAGCCAGGGGCGCGTGTATGGGTCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62