GenePrediction:GLEAN_7836 Details

Name: GLEAN_7836
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2704388..2703763 (- strand)
Length: 626
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2704388..2704340 (- strand)
Length: 49
Type: CDS
Source: GLEAN
Position: GCSC_113:2704274..2703763 (- strand)
Length: 512
>GLEAN_7836 class=GenePrediction position=GCSC_113:2704388..2703763 (- strand)
ATGCGTGTCTCATTTGTTGCTCTTGCTTGCGCCACCGGCGCCCTGGCTGGTAAGTATCTTATACATGTGCCAAGCACACC
ACGGGCCTCCTGCTGACAGTCTTCCGCGCGACAGCGCCGCTGATCCAGCGCTGCAACCTCTGCACCATCGTCGGCTCGAC
CACGCTGCCGGCCGAGACGCTCGACGCGGCCAACGCGCTGGCCAACACGGTCACGTGCTCGACGACGACGACCATTGGCA
CCGTGCCGGACGCCATCTCGGGCGACGTCAAGTTCAGCAGCATCAATTTTGCTGACTCCAAGAACTCGACGCTCGGCTTC
GCGCTGTCGACGTTTGCCACGGCAACGCCGCTCGCCAGCACCGATCTCGCGCACTTCCAGAACATGCTCAACGTGTACGT
GGCCACGGAAGCCGGCGTCCGCTCCGTGGGCGGCTCGCTGGCCGTCAAGGTCCCCAAGTTCTTTCTCGAATTCCAGGTCT
CGCGCATCCAGACGGCCCAGGGCAACGCCCCAACTGACGCCTCCCTGACCGTGCCCCATCTGCTGACCAAGGTGCTCAAA
AACGCGGCCGGCCAGAGCCAGGCCTTCCTGGACGAGGTCACCGCCCTGTCGAAGCAGCTCAGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62