GenePrediction:GLEAN_7837 Details

Name: GLEAN_7837
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2701572..2698058 (- strand)
Length: 3515
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2701572..2701453 (- strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_113:2701392..2698515 (- strand)
Length: 2878
Type: CDS
Source: GLEAN
Position: GCSC_113:2698437..2698058 (- strand)
Length: 380
>GLEAN_7837 class=GenePrediction position=GCSC_113:2701572..2698058 (- strand)
ATGCCGCACTCGGAGACTGGCGGGCCGCTGGCCAAGCGCCAGAAGCTGAGCGTGGGCGAGAAGAAGCCTCGCCGAGATGC
TGTCGAGTCCCGGGGCTCCAACGTGTTTGCTCCATTCCGCGTACGTTTTTACACTCTTCGATTGACATTCTCCCATGGAG
ACATAGTGTTGACCATACAGACCGTCGGGCTGGTGTCCCCAACCAACGTGCCATTCTCGTGCCTGCCAATGGGCAAGACG
ACCTTCCAGATCACGACCTCCGTCGGCCGGGCGCTGCAGACGTACGATCTTCGACGTGGTCTGAATCTTGTGTTTGTCAC
GAGGCCCCAGACGCCCCGCGACATCACGGCCACGTTTTCCTGGAAGAAGATGGTGTTTGCAGCCTGGGGCGGCGGTGGGG
ACGACAGCGACGACAGCGACGACAGCGACGAGGGCGAGGCGGACGGACCGTCGACACGGCAGGGATTCTGGGTCTTCCAG
CGCGGCCGCAAGACGGGCGAGATTCCACTACCGGCAGACCTGGACGAGCCGCTGCGGCAGATCATCGTGTTTGGCTCGTG
GATCGTGGGACTGGCACGCACGCGCATCGAGGTGTGGAAGTCGGCGACGTTTGAGCACTACACGACGCTGCACCCAACGG
CAGCACAGGCAGGCGGAAACGAGCTGACGGGCGGCATGTGCACGATGCCGACACTGCTGAACAAAGTGTTTGTAGGCCGT
CGCGACGGCTGGGTAGAGATGTGGAACGTCAGCTCGGGGCGGCTGGTGTACACGATCCTGCCACCGGGACCGAACAGCGG
CGCGGTGACGTGTCTGGAGCCGACGCCAGCGCTGTGTTTTTTGGCGATTGCGTACGACAGTGGGCCACTGGTGATCCAGG
ACGTGGTGCACGACAAGACGCTGCTGGCGCTGGACGCGGGCACGGCGGGCGTGACGGGCGACGGCGAGAACGATGCGCCG
GTGTGTTCGATCTCATTCCGCACTGACGGTCTCGGCGCCGGCCAGGACGGCCGCACGGAGGGCGTGATGGCAACGGCGTC
GGCAGCCAGCGGCGACGTGACGTTCTGGGACCTCAACAACGGCGGCCGCATCATGGGCGTGCTGCGAGGTGCTCACAACC
CGCCGTCGGGCGAAGAGGGAAGCAACGTGGGTGGCGGCATCAGCAAGGTGGAGTTTCTGCCGGGCCAACCGGTGATTGTG
ACTAGCGGACGCGACAATGCGCTCAAGACATGGATCTTTGACGAGACGCCCTTCTCGGCGGTGCCGCGCGTACTTCACTC
ACGCAGCGGCCACGCGGCACCGGTGAGCTGTCTGGCCTTCTTGCCGACGGACTTTGACGGCGCTGACGCTGGCAACAAGT
GGCTGCTGAGCGGCGGCCGCGACCGCAGCCTCTGGGGTTGGAGTCTGCGGCGCGACGGCCAGAGCAGCGAGCTGAGCCAG
GGCAACATCCGGGCCAAGGCGAAGAAGACGGGCATCCTGTCGGCGTCGGCACTGCGGCACGGCCCCACAACAAGGCTGGA
GGACCTGAAGGCGCCAGAGATCACGTGCATCGCATCGTCGTTGAACCGGGACGGCGGCATTGGAGCATTGCCGGGCAAGC
AGCCGATCTGGCACCGGGTGGACACGACAGGACGCAGCAAGAACCGACCGACACGGGCACTGGACGCCGAGGTAGCCGGG
ATGACGGGATGGGAGAGTGTGGTGACGGCGCACAAGGGCGATGCCTGGGCACGCACATGGTTCTGGGGCCGCAAGCGGGC
GGGTCGCTGGGCGTTTCCGACAGGCGATCAGACGGCGGTGTCGACGGTGGCCATCAGTCCATGCGGATCGTTTGCGCTGG
TCGGATCGGCTGGGGGAGCACTGGACATGTACAACCTGCAGTCGGGGCTGCACCGACAGCGGTTCCCGTCGCGGCTGACA
CCGGCACAGGCTCGCCAGCTCAAGGTGCAGCAACAGCTGAGGCAAGCCGACAGCGTGGCACAGCTGCAGGCGGCAGCAAC
ATCGGGACCAACACCGGGCACGGGACGACACAGCAAGGCGGTGACAGGCATCGTGGTGGACAGCCTGGACCGGTTTGTGG
TGTCGTGCTCGCTGGACGGGACGATCAAGTTCTGGGACCTGCTGACGGGCCACCTGGCCTCGCAGCTGGACTGGGCGCCG
CTGGGCGTGGCGGTGACGGGCAGCCGATACCACGCGGCCAACGACCTGGTGGCGTTTGCATGCGACGACAACGCGATCCG
GCTGGTCGACCTTGAGACCAAGAAGACGATCCGCGAGTTCTGGGCAGGCAGCCGTGGCGGCGAGGCCGGACGGGCTCGCG
GCCAGATCAACGACTTTTGCTTCTCCAACGACGGACGCTGGGTCGTGGCCGTGACCCAGGACGACGCCCGCCTGCGCGTG
TGGGACCTGCCAACGAGCCACCTGGTCGACTCGGTCGTGCTGGAGCACGCCGGCCGCGCCCTGGCCTTTTCGGGCACTGG
GGAGTACCTGGCCGTAGCGCCCGACAGCGCACTAGGCGTGCACATCTTTACGAACAAGACCCTGTTCACGCATGTGCCGA
CGCGGCCGGTGGTCGAGGGCGCAAGCCGGGAGAGGCAGAAGCAAAAACGCATGGCTGGACCGACGGCCTCGGGCGAGGGC
AGTGTCGGACTGTTGGATGCTGCTTTCGACCAGGAGGACGACAAGGAGGACGACAACAACACCAACGACGACATCCTCTC
GGCCGTCACCATCGACCAGCTCAGCTCCGACATGACGACGCTCAGCCTCGTGCCCAAGAGCCGCTGGCAGACGCTGCTGC
ATCTTGACGTGATCAAGCAGCGGAACAAGCCGCTGCAGGCGCCCAAGGCCCCCGAGAAGGCGCCATTCTTCCTCGGCGCC
GTGGCCTCGGCCGCGGCAGAAGATGCGGCCATGCGCTCGCTGACGCCTGCGGGAGGCGGTGGTGATAGTGCCGCCGCTCT
CGACAACACGACGCGGTCACGCATCCTGACGTTGGACTACAGCCGGGGTCAACAGGCCTTTTCGATGAAGCTGCACCAAG
GAGGTGCGACGAATGATTGTATGTTTTTGGAGGGGGTTTACTTCTTGTTTCCGTCTTCTTTACATCGTTTTCTTTTCTAT
CTGCTAACTAGCCAGTTTCTCCCTTTGTCGATCACCTCAAGCTGCTACCCCCTGCCCAGGCCGATCTGGAGCTGCGCTCT
CTGGCGTCCGAGCAGGGCGAGCTCGGCCTGTTTGTGCGTGCGCTGACCAGCCGGCTTCGTGCGCGCCGCGACTACGAGCT
CGTCCAGGCCTGGATGGCCGTTTTCCTGCGACTGCACGGCCCGGCCGCGGTGGCGGCAGCGGCAGCACAGACGGCCGACA
AGATGGACGACGACAGCGACGAGACGGCCGACAAGGGTCTGGCGGCCGCGCTGGCCGAATGGAAGAGCGTACAGGACGGC
GAGCGGACGCGGCTGGACGGGCTGGTGGGCTACTGCGGTGGCGTGGTGAGCTTCCTGCGGAGTCCGCGGAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62