GenePrediction:GLEAN_7839 Details

Name: GLEAN_7839
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2696236..2692609 (- strand)
Length: 3628
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2696236..2695930 (- strand)
Length: 307
Type: CDS
Source: GLEAN
Position: GCSC_113:2695731..2695125 (- strand)
Length: 607
Type: CDS
Source: GLEAN
Position: GCSC_113:2694815..2692778 (- strand)
Length: 2038
Type: CDS
Source: GLEAN
Position: GCSC_113:2692641..2692609 (- strand)
Length: 33
>GLEAN_7839 class=GenePrediction position=GCSC_113:2696236..2692609 (- strand)
ATGTTGTCCAACCCGCTGCACCGCTTCTCTCCCTATCACGCCATCTCGTCCCCCATCAGCCACCATCCCACAGACACCAT
GCACACGTCCGATCTCGACGCGCTCGCCCAGGGCTCCCATCTCGCCCTGCAGCAGCTGCAGCATCATGTCGGACTGCAGG
TGAAGCATCGCCAGAATACGTACGGGTCGGCCGGAGCGCCCAGTGCCAGCGTAGGGCATGTTCGCCGCCGCATCAGCAGG
GCTTGCGACCAGTGCAACCAGCTGCGCACCAAATGTGATGGCCAGAACCCGTGTGCACACTGCACTGGTATGTCGTTTGC
TCCTTTGCGTCTTTGCGTCTTTGCTGCCTCGCCTTCTGTTTCTGGCCTCCCTTGGCGCCTTCCTTGCCTGGATACCAGCT
CCTTCCGTTTCCTGTATTATACGGGTTCTGCCATTATCAGGCAATTCCCCCTCTTGTCCGCCCTTCCGTCTTCTTTGCTT
TTTGACCACGTCCACTGACCGTCAGAATTTGGCCTTGGCTGTGAATACATCCGCGAGCGAAAGAAGCGTGGCAAGGCATC
CCGCAAAGATCTCGCCCGCCAGGCCGCTGCTCAGGCTGCCGCCACCGCCGTCTCCCAGGGCAAGACGGATGACGGCCAGA
ACAGCGGCGATTCTTCAGACCAAAATGACGGCATCGGGCGATCCAACAGAGAGTCCGTCATGATTGCGAGTGTCGAGCAG
AGCGGCTCTGCAGCCGTAGCCATCACTACACCAATCATCGGTGACAGCCTGATGAGCGATTTGGCCGATGACGAGCTGCA
GCGCAGCCGGCGAACAGGCAGCCTGGAAAGCCTTGGGGACATTGGAAGCTTGCACGTCCAACTAGACCACAGCAGTACGC
AGCAGCAGCAGCAGGGCCTGGACAGCTCGCCTGTTCCCAGCCTCGACCTCAACGGCTACGGCCCCGTCCACACACCGCCG
TACGCCCAACGCCAGGTCGCCGCCTCTGCAGCCGAAGAGTCGGCCTTGAGTGCGATGGGCTCCTTGGGGGCTGCCCACGT
GATGAATGGAGTGGCAACAGGTCACACATCTTACACGACGCCGGCCGCCATGTCTGGCTATCCAGACCTATCGTACGCGC
TGCAGACGTTGAGCAGCTATCCGATGGCTGGAGAGCCGGCATCGCCTCCCTGGCTGACCATGCCATCGCCCCCGCCACCT
CAACAGCAACAGCCACAACAACAACAACAACAACAACAACAACAGCAGCAGCAGCAGCAGCAGCAAAGACAGCAGCAGCA
GCAGCAGCACCATCGCCAACATCACCACCAACAGCAACGCATGCAGCACATGCAGCACCAGATCCAGCCTCAGAGCCAGT
CCCACCAGCGGATGTACCAACAGCCATCCTCGGCCATGCTTTCCACTTCCAGACTGTCCAGAACCTACAATCTGTCACAG
CTTCGCTACCCCGTGCTCGAGCCGCTGGTCCCACATCTCGGCGGCATCATGCCTCTGTCGCTGGCCTGCGACCTCATCGA
CCTCTATTTCACCAGCTCGTCGTCCGCTCGGATGCACCCAATGTCGCCCTATGTGCTCAGCTTTGTCTTTCGCAAGCGCT
CCTTTCTGCATCCTACGAAGCCTCGCCGCTGTCAGCCCGCCCTGCTGGCCAGCATGCTCTGGGTGACCGCCCAGACCAGC
GACGCCCCCTTCCTAACGCGCGTCCCCTCAGCTCGCCTCAAGACGTGCCAGAAACTGCTAGATCTGACGATTGGCCTCTT
GAGGCCGCTGGTTCACGCGCCATCGTCAGCTGCTGACATGGGCTCACCCACCGACAACTCCACCATGTCCTCGATGCTTG
CAATGGGCGTCATGGGAGCAGTAAGCAATGGCCTAGGCATGTCTTTAGGCGGCGACTCTTTCGGCTTGGAGGGCGGTCTT
GCCGGCCTCTCTGGCACTGCTGAGCACAGTGGTGGCGGTAGAGCTGTCTTTGGTGCTGCCGGTACGCTCGACGACGTCAT
CACGTACATGCACTTGGCTACTGTGGTCTCCGCCAGCGAGTACAAAGGAGCCAGCCTGCGCTGGTGGAATGCCGCATGGT
CTCTGGCGCGTGAGCTCAAACTGGGCCGCGAACTGCCGCCAAATCCGCCAAGCCGGATGCCCAACCCGATGTCGCACCAG
TACTATCACGGCAGCCAGGCCCTGGATGGAAACGACCTAGGTGCCGAGGATGAGAGCGAGGACGGCATGGTTGTCTCAGA
GGAGGCACGTGAGGAGCGCCGTCGCATTTGGTGGCTGGTCTATCTTGTGGACCGACACCTGGCTCTGTGCTACAACCGTC
CGCTTTTTCTGCTGGATGTCGAATGCGAAAACCTGCTGCAGCCCATGGACGAATCGGCCTGGCAGAACGGCAACTTTGAG
AAGAACACCAGCACCAACATCAACACAGCCACCGGTCCGGACGTCGAGATCAACTTGGCGTCGACGCCTAATCCCCTGCT
ATCGCCTGACGATGGCACAAGAAAGAGCGACAACAGCCCTAGCAATTCCCGGGGCCCCACATTCATCTGTCGCGGCCACA
GCATCTTTGGCTTCTTCTTGCCTCTCATGACCATCCTCGGCGAGATTGTCGACCTGCATCATCTGCGAAACCATCCGCGC
TTCGGCGTAGGCTTCCGCTCGTCGCGAGAGTGGAAAGACCAGGTCGCCCAGATCACCCAGCATCTCGGCATCTACGAGCA
GAGCCTTCGGGCTTTTGAGCAAGAGAACCTCAACCCTGCTGTCCTTGCTGCTGCTGCCCGAGACGAGCAGCGGCAGCAGC
AGCAACAGCAGGCAGAAAGGGAAGCAGCCGAGAAGAACGGGACCAAAAACAAGACGGCTTCTGACGGCAACGCGATTGGG
TCTCCTCAGGCCGTGGACACGCCGCTAAGCCAGCAAGATGGCTCTGCTGCCACAGCTGATATCGCCGCTGCCATCTCCAA
TGGCCCTGCTGCTTCTGGACCGGTTCTTTCCCCTCCCTCATCCTCACCCTCCTCTTCTCCCTCTCCTCCGCTTCGCATGA
CCGAGCTCGACATCCAGACGTCCATCGTCACCGCCTATGGCACTCACGTCATGCACGTTCTGCACGTCCTCCTGATCGGG
AAGTGGGATCCCATCAGCCTGCTGGACGACGACGATCTGTGGATCAGCTCGCCTGGATTCATTACCGCCACTGGCCACGC
CGTCGCCGCGGCCGAGGCTATCAGTCGTATTCTCGAACACGATCCGGGCCTGGAGTTCATGCCCTATTATTTCGGCATCT
ACCTGCTGCAGGGATCATTTCTGCTGCTGCTCATCGCCGACAAGCTGCAGCTCGAGGCCAGCGCCAGCGTCACCCGCGCC
TGTGAGACCATTGTTCGTGCTCACGAGGCCTGCTGTGTGACGCTGAACACCGAGTACCAGCGCAACTTCTCGCGCGTTAT
GCGCAGCGCCTTGGCGCAGGTGCGTGGACGAGTGCCACCGAGTGGAGGCCGCGACGACGGTGGCCATAGTGGTGGCGGTG
GTGCCATTGATGGCTGCATCGGCGGCGGCAGTTTTGGCAATGGTCATCACGGCAGCAGCTTGAGTGATAGTGCAGACCAG
CCACAGCGACGCCGACGAGAGCTACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62