GenePrediction:GLEAN_7840 Details

Name: GLEAN_7840
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2680291..2678215 (- strand)
Length: 2077
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2680291..2679621 (- strand)
Length: 671
Type: CDS
Source: GLEAN
Position: GCSC_113:2679540..2679042 (- strand)
Length: 499
Type: CDS
Source: GLEAN
Position: GCSC_113:2678955..2678215 (- strand)
Length: 741
>GLEAN_7840 class=GenePrediction position=GCSC_113:2680291..2678215 (- strand)
ATGGCTTCGGAAGCAGAACCGGTCTCCGACGCAGCATCTCGGGGTCCTCCTCACGGCGTGAAAGTGACGCCCATTCCTCC
TCCACATATTCCCTTTCCCACGGCTGCTTCCTCGACAGCTGCTGCGACGGCCACATCCATAGCAGCACCAACAGTAGCAT
CGCCCATGGCGCTGGCTGCTGTATCCGACGATGGCTCGCCGGCCGAGACGGCTGTACCGCCGCAGTCTCTGCTCTCGACC
ATTCCCCAGAAGCGCGCTCTCGGCGACGAAGACCACACGCCGGCAGTGCGATCGCCACTCAATCCCGACTCGCGAGCCAC
GCCCGACGTGTCCGTGGTGGCGCCGGCGCGCGAGAAGCGGACCAAGAAGGACTCGCTGAAGAAGCGCGAGTCCAAGAGCT
CCGAAGCATCACGAGCCACGCCCGAGCCGAGGCGCAAAGAGAACAGTTCGGGCGCAGGCGGTGGTGGTGGCAGCGGCAGC
ATCCACAGCAGCGGTGCAGAGGTTGTGGATGGTAGCACACCCAGCGACGGACTGCCAGTGCGGGTGCGTCTGGCGGTGCC
GCTGCGGCCGAGCGACTTTGACCAGCCGGCGAGCCCCATCTTCCGCAGCCATCACAGCGCAGAGGTAGCCAGCGGACAGG
AGGTTGAGTTTTTCGAGCTGTTTACAGAGCAGTATGTCATGGCCTGAGATGAAGATGAAGATGCACGGCCTGATTGGAGC
TGAAGCTAAGCTGACCATGTTCTCCCACCAGGCCCATCAACCGTAGAGGTTACGTCTACGAGAGCGGCATCGCCGACCCG
CGGTTCCCGTCGATCAACTACTTCCGGCAGACGGAGCCCAAGCCGCACTATGCGCACTTCTGCTTTGAGGACGCTCCGGC
AGGCATGTTCTTCGACCAGTCGGGGCTGCAGGTGAACGGCGACGCAGGCTTCCGGACGACACGGGCCAACGTGGCAGCAC
GCCAGGGTCGGTGGTACTGGGAGTGCAAAGTAACGCGGGGCATCGTGCGGCAGGCCAAGGCTGGCGAGCCAGACGCGCGA
GGACATGTGCGCATGGGTTGGGCGCGGCGGGAGGCGTCGCGCGATGCGCCGGTGGGCTATGATGCCTATGGTTACGGCGT
GCGCGACCGCAAGGGCCAGAAGATGCACATGTCCCGGCCCAAGGACTGTTTCCTGGACGACGAGGACATTCGCGAGGGCG
ACGTGATCGGGCTAGAGATCCAGCTGCCGTCCGAGGCGCTGCACCGCAAGGTTTTGTGCAGGGATCGTACAATCCGGCCG
TCGATCTGGTGGACGGGAAAGACGGCAACGGAGCAGATGGGCAAACAGATGACCAGACAGACGGCCGGAATGGCGACACG
GCCGAGGGGCCCAACGTGCTTCGAGACCGCAACCCGTTCCGGTTCCAGACGTCGAAGCTGGTGTTTGAAAAGTTTGACTA
TCTGCCAATCAAGGAGCTGGAAGACCTGGCCAACGCAGCACCGACGCTGTCGACGTCGTCGGCGGGTGCGATAGAGCCGC
CGAATCCAAACCACGCAGTACCGTGTCTGCGGACGCTGCCGGGGTCGTTTGTGCGGGTGTACAAGAACGGGGTGCTCCAA
GGAACGCCGTTCACGAACCTGCTGTCGTTCCTGCCGCCGGCCTCATCGACCAATGCCAAGATGCAGGAGGGCGCGCGCGA
GCGGCTGGATGACGGCACGCTGGGCTACTATCCGGCCGTGAGCACGTTCCGAGGTGGCGCTGTCGAGGTCAATTTTGGTC
CGCACTTCTGGTATCCGCCGCCGGAGCTCGAGGCCGCCGCGGCCGACGACGTGATGATGGTTGACGTGGGCGGCGGCAGC
AGCAGCGATGATGTGGCTGACCGCGGCTCCGGACTGCTGGCACCGTCGTCGCTGACTAAGCTGAGACCCGTGGCCGACCG
TTACGAAGAGCAGATTGCCGAGGACATTGTGTACGATCTGGTCGACGAGGTCTACTTCTGGGTCCTGGACGGATGCAAGG
CCGAGGCCGGTGGCGGCGATGCTCCGGCGGGCGACGTGAACGAGGATATGTCCATGGATGAGGGAATATCTGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62