GenePrediction:GLEAN_7842 Details

Name: GLEAN_7842
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2663514..2660861 (- strand)
Length: 2654
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2663514..2663371 (- strand)
Length: 144
Type: CDS
Source: GLEAN
Position: GCSC_113:2663303..2663243 (- strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_113:2663187..2660861 (- strand)
Length: 2327
>GLEAN_7842 class=GenePrediction position=GCSC_113:2663514..2660861 (- strand)
ATGCTGTTGCTTTCTCTGGCTGGCGTCCAGAAGACAAGCATCAGCCTGCGTTTCGTCCGAGCAGCACATTCTAGCGGGCC
GGCGTACTACGATGCGAAAATCGAGGACATACGAAATGTCGGGATTATTGCCCATGTGGATGCGGTAGGTGAATCGCGCT
GAGAATGACACTTGAATAAGACGTGTCCGATGCTGACCTATGCTGTTGCAGGGCAAGACGACAACCACAGAGCGCATGCT
CTACTATAGCGGAGTGACTCGGCATCTGGGGAGTATGTGTATACGTGTTGGTTATGGCCTAGCCTGTTACTAACGCAGCT
GCTGCAGACGTGGACCATGGCGACACAATTACGGACTTTCTGCCCCTGGAGCGACAGAGGGGTATCACGATCCAGTCGGC
GGCCATCAGCTTCAACTGGCCTCCGCGACAGCACCTGGCGGAGGGGGTAAATGCCAAGACGATTAACCTGATCGACACGC
CGGGACACCAGGACTTTCGGTTTGAGGTGGACCGGTGCCTTCCGGTGCTGGACGGAGCGGTATGCATCATCGACGCGGTC
AAGGGGGTGGAGGCGCACACGGAGCGAGTGTGGTCGTCGGCACAGCGGTACGGAGTGCCGCGGATCGTATACGTCAACAA
GCTAGACCGCGATGGGGCATCATTCAAGCGAGCGGTGCTGGACGTGGCGTCACGACTAAATGCATATCCGCTGGTGTGCC
AGCTGCCGCTATGGGAGAAGGAAGACAGCTTCGTGGGGGTAGTGGACGTGATCCGACGGCGGGCGATGAAGTGGACGGCG
AGCGGGACGTGCACGCTGGTGCCGGAGGCGGCGGTGCGCAGCAACGAGCGGTTGTGGGAGGAACTGGAGACGGCGCGGAC
GCGGCTGGTGGAGCGGCTATGCGAGGACGACGATGAGCTGGTGGAAGCGTTTGCCGAGGTGGGAGCAGACCTGCCGGCAG
ACATGATCGTGGACAGCATTCGACGAGTGGTGCGCAACAGCGGCGGGCTCGTGGTGCCGGTGTTTGCGGGCTCGAGCCTG
CGCAACATTGGCGTGGAGCCGCTGCTGGACGCGATCGTGGACTATCTGCCAAGCCCGCAACAGGCGCCGGACGTGAAGGT
GCAGGTGGGGGGCTCGGAGACGATGACGCTGGGCGAGGCGCTGCGAGCACACGACGACGGGCGGGCGAAGACGGCGAAGA
CGACGAAGACGACACAGCAACACCATCCGTCGGTGGGCGCGGTGGCGTCGGTGTTTAAGGTGGTCAACGACCCGGCGCTC
TTTCCGGGGACGCACGGGATGCTGACGTTTGTGCGGGTGTACCACGGGGCGCTGCACAAAAACGCGCAGGTGTGGAACGC
CAACCTGGGCCTGTTTGAGAAGCCGTTTCAGATTGTGCAGGTGGCGGCGGCGCAGGTAGGCGAGATCCCGTATTTGTCGC
CGGGACAGATCGGAGCGGTGACGGGCCTCAAGGCGGCACGGACGGGCGACACGCTGCACATTCTGCCGAGCCATAGCCGG
GGAATGCCGGTGGCGCGGTTGCGGACGATGACGATCCGACCGGCAGAGATGCGGCCGGCGGTGGCATTTGTGTCGGCCGA
GGCATACGGCACGAGCGAGACGAAGCGGCTGGAGGAGGCGCTGGGCAAGCTGTCGCGCGAGGACCCGAGCCTGCGGTGGA
GTAAGGACGAGAAGCTCGACACATTTGTGCTGTCGGGCATGGGGACGCTGCACCTGGACATTGCCATTGACCGGCTCAAG
ACGACGTACAAGGTCAACGCAGCGTTCAGCGACGTGCAGGTCGACTACAAGGAGTGTCTGACGGCGGCGACGGCGCGGCA
TCACAGCGTGTACGACCGGGTGATTGCGAACAAGGCGGGACGAGCGGGCTGCACGGCGACGATTGCGCCGTTGAAGGGGG
GGGGGGAGAGGGAAGAAGCGGGAGAGATGGAATACAGGCGCACAATCGATCGTGACGGCAACGTGTACGAGATCCGGTTC
ACGACGGCCAGCGGCAGGCTCCCGTTTGACGCAGACGAGCTCAGCCGGCAGCTGTTCAGCGGCGCATACGGGGCGATGGC
ACGAGGGCCCCGACGTGGATCTCCGCTGCATGGTTGCCGGGTGGTGCTCGAGTTTGACGTCGAGGCAGACTATGGCGGCG
CGGGCACGGAGGGTCACGTGGTCAATGCGGCGCTGCAAGCGGTGCGCGGGGCACTGCGTGAGGCGCACAGCCACGGCACG
GTGGCGGTGCTAGAGCCGGTGATGCTGGTGCACATTGGGTGTCCGGATGACAGCGCAGGCGCGATCCAGCGCGACATCAC
GGGGTCGCGCGGCGGGTTCGTGCACGAGGTGCGAGAGGGAGGGAGTGGTCGACCAAGTGCCGAAGCCGAAAAAGGCGAAA
GTACCGAAAGTGCCGAAAAGACCATCAATCTCGGGCAGGTGTACGCGCCGGCCGACCCATACGAATCTGTACAGTCGCTG
CGGGCGACCAAGCGCGGCGTGACGCGCATGCTGGAAATTGTGGCGCGTGTGCCGCTCAAGGAGATGCTCTCGTACGACAG
CCGGCTGCGCAGTATGACGGGCGGGTGGCACTCGCTGACGATGGTGCTGGACAGCTTTGAAAGGGTGATGGGTTCGCGCG
AGAAGAACGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62