GenePrediction:GLEAN_7844 Details

Name: GLEAN_7844
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2656702..2652531 (- strand)
Length: 4172
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2656702..2656425 (- strand)
Length: 278
Type: CDS
Source: GLEAN
Position: GCSC_113:2656088..2653303 (- strand)
Length: 2786
Type: CDS
Source: GLEAN
Position: GCSC_113:2653243..2652531 (- strand)
Length: 713
>GLEAN_7844 class=GenePrediction position=GCSC_113:2656702..2652531 (- strand)
ATGATAGAAACGAACATAAGCGCAGCCAGCAGCCCGTCGACGAACGGCAGCCACAAGAAACATCTGATCCCGCGGTCCAT
CTCCGTCAGGCGGCGGCGGAAGTCGCTTAGCAGCGGCCACAGCAGCGGCAACGGCAGCCTCAACGACACCACAATGTCTC
CGCAGTCACGCGGTCGTGATGTTCGAAGCCGCGATGCGCCAGACGGGAGCGACGGCGACGAATCCCTCAGCCAGGCGGAC
GAGAGAGGAGCCGCAGCAGGGGCGTCTGCCACAGACCTGTAAGCAAGCAACTAACCAATTTACCCTATTCTCGTTTTTAT
TACCCTGTGGATCCGCCATTACACGAACGCACTTGGTGCAGCCAAGAAACGCCGGGAAAGACGAGAAATACGAGAGCGGC
GCGGAGATGATGAAAAGGGGATCCGGTCAAGTCTGGTGGCCGCTCTGCACAAGAGCTCCGCTTTTGAAGGAGCCTCTCCT
GCTCTTTGAGACCGCTCTTTCTAGCTGCCGCTTTCTGCTCCCACCGCCTCGCCGACCATTCTGGCACTGATTGCTTTTTT
TCTTGCTTCTGTCCCCACAAAGCTTCTTCCTAGCTCTGACTTGTTTTGTCACAGTCCACTGCCAGCGCCCCTTTCCAGCC
ACCCGTCCCAGATCGGATACCTCACGACGTCATCGCCGCTAGTCCAGGCGGAATACGTCCACGGAGTCCGGACGCCGACT
CAGTCAGATTACGAGAGGCTCGGGCGAACCTCCACCCTGTCCGCCAAGCCCACCAACTCTGGTGCTTTTGTCCCGACCTC
CACCGTCACCATCCAGACCGGCCTTGCGCCTCCCCCGTCCAAAGTACGAAGATCCCCGTCGCCCGCTGGCCGTTTCCGCG
ACGTCTTCAAGTCTCGGAAGAGCTCTAGCACGGCCAACTCCAGTCCGGAGCGGGAGCGACAGCATCCCGACCACAACCAG
CTCGATCGGAGCATCAAGAGCCCAGAAACCCGAAACCCGAACATCTCGGCGGCCCCATCTCCAGTCGCCCCTCCTCCCGT
ACAGACACCCATCCCCGACGCGTCTTCGGCCGAGGGCGCAAATCACAACGGCGAGCCATCTGATGCGTCCAGAGTAAAGG
CGGCAGACCGATTTCGCCGTCTCTCCAAGGGCCAGAAGATCGAGACCGGCCTGATTGCGGTGCGGCCAGAGACCCCACCC
TCAAGCGAGACGTCTGCCCCTGTCATCGTCAACACTCCTCCCACACCAACCGAGTCGATCCACCCAGTGGCTCTCTCTGG
CACTCGGCACAGAGCATCCCCAGGCACGGCCACCCTTCCATCGATCGACGCCCCCAATGCATCCCCTGCTGCTTCCATAA
GCAGCAGCAGCATGATTTCGCAGAGACGAGCACGTGCAGGATCTCTCGGACCAAGCAAGCTGTCCAACTATACGCTTGCC
CCTATCTCACCGAACCCCGACTACGGACAGGCCGGCCAGACGACCCCCTCGAGCGGCTTCTTCTCGTCTATGTTCTCGGT
TGCACAGAATGCTACAAACAGTCTGAGCAACGCCGTCACCAACACCAACATCTCCAGTCCGTGGAACAGCAACAACAAGA
AGCCGGGGACGACCACGTCGGGCAGAGAATACGACGCCGACGACGGACAGGAAGCCGAGGGTGTCGAGGTAGAGTCTTCT
CTCGATCTCGGTCTAGCACCTTCTCTCACCTCATCGCAGCCGAAAGAGCCTGCGGTGAAGACGCTTGGTCTTGGAGACCT
CAGCCTGAGCCAGCTGGGCATTATCGACCAGCCAGAAGAAGAAGAAGAAACAAAGGCAGCAGTGGCCATACCGCCCGCCG
CACACGTGCAATCCAGGATGTCGGAAGGCGGGTTTGAGTCGAGACGGCGGTCGGAGTCGGCTCCTGCTGACCCGTCCATC
CTAAACAACCCGTCCGAACAGGAGGAACATGGCGCCGACGATGCGGCGTTGCTGGCCGTTCGGCCGTTGTCTGTGTCGGA
TGGGACCGGCCACGAAGATGGCACGCCGCCGACGACCAGCATAAATGGCGACAAGGAAAAGGCCTTTGCGCTCCATCGCT
CCGGCAGTGCAAAGAGCGCGCACGGGCGGCGGAGAGGCCGCAACAGCTCGGCTGCGAAGGGCGGTGCGTCGAATACGATC
GCGGCTGCAGTTGCGGCGGCCAACCTCTCGGGCGTCAACCCAACGGTGCCGGGGAACGCGCCCAAGCTGACGGGCTTCGC
GGTGGCCAGCAAGAAGCGGAACCGCGAGTTTCACAACCTGTTCAAGAGCGTGCCCGACGACGACTATCTCATCGAGGACT
ACAGCTGTGCTCTGCAGCGCGAGATTCTGGCGCACGGGCGCCTTTACGTATCGGAGGGCTACATCTGCTTCAGCAGCAAC
ATTCTCGGCTGGGTGACGACGCTGGTGATGAGCTTCGACGAGGTGGTGTCGGTGGAGAAGCGGAGCACGGCTCTCGTGTT
CAAGAACGGGCTGATGATCTCGACGCTGCACGCGAAGCACATCTTTGCCAGTTTCGCGAGCCGAGACTCGACATACGACC
TGATTGTCAAGATCTGGAAGCTCGGCCACCCCAGCCTGCAGAGCTCGCTGAACGGAGTGCACATTGACGAGACGGGCGGT
GACAAGACGGAGAAGATCGAGGACCGGGGCGATGTGTCTGTCGAGAGCCGCAGTCTTTCAGCATCGGAGGACGAGAGCGA
AGACGACTCGGACGAGGTGTACGACGAGGATGCGGAAGACGAGGATATGCACGAGACGGCATACGTGTCGGATGCAGGCG
GCGCAGCGGCCGACACAGGCGCCGAGAAGGCGGTGACGCGCAAGACGTCTGGCACAGCGTCGAACGGAGCGGCGGCCGAC
AAGCCCAAGGACGCGACGGCACCGGCAGCAGGCGGCGACTTCCCCGGCCCTCTGACGCATGCGGCGACCGACTGCGGCGA
CACAGGGTCGCACTACGACAGGATCCTCGCAGACGATGTGATTGGGGCGCCGCTGGGGAAGGTGTTCGGCTACGTGTTTG
GAGCGACGTCGGCGACGTGGATGATCAAGTGGCTGTCGAACGACCAGAAGTGCCTGGACGTGCAGGTGTCGGACAAGAAG
GGCCTGGGCCCGGATAATAAGACGCGGACGATATCGTACGTCAAGCCGCTGAACGCGCCGATCGGGCCGAAGCAGACCAA
GTGCATCGTGACAGAGACGGTGGAGGCGATTGATTTTGACAAGGCGATCAACGTGACGTGCGCGACGCAGACGCCAGATG
TGCCGAGCGGCAATGTGTTTACGGTCAAGACCAAGTACTGCTTCTCGTGGGCAGAGAACAACGCGACGCGGGTGCAGATC
AACTGCACGATTGAGTGGACGGGGAAGAGCTGGTTGAAAGGTGAGCTTGCGTTTTGTGTTCTGTGTTCTGTGTTCTGCAG
ACTTTGCTAACAGGTGCAGCACCGATCGAAAAGGGGGCCAACGACGGCCAGACGCAGTACTCCAAAGACCTGTTTGCGAG
CCTGAAGGAGGCGCTCTTGTCGTCGTCACGGTCGCGTGCCGTGGCAGGCGAAGATGGGCCGGGAGCCAAGGGCCGGAAAA
AGGGACGAAAAGGCAAGCCGGCTCCATTGTCGGGACCGACACGCGAAGTCGAGAGCGTGGCCAAGAAGCCGGAAGTTAAG
GCAGACTGGGGGCCATTGGAGCCGGTACGCGGGTTGGTCGAGCCGCTGATGGACGTTGTGCAGCCGCTGCTGACGGGCAA
CGTGATGTACGGGCTGCTGGTCGGGCTGCTGGTGGCAGCATGGTTCGGCTTTGGCTTAACGTCACGCCGACAGCCGCCGA
TGGGACAGCCGGGACAGCTGGGATACGGCGGCAGCAGCAGCGATCTCGGCTACCGGGCAGCCTATCCGGAGCGTGTGGCC
GCGTACGACGAGATCTGGCAGCGCGAGGAGAGCGAGCTCTGGAGCTGGTTGGAGGAGCGGGTCGGACTCGACCGACGGAT
GGACGGTGCCAGCGCCGGTTCGAAGAGGGGGATGGACGCCCGAGTGGTCCAGGACAAGCTGCACGACGATCCGATGGACA
GCCGGGACATTCAGGAGGCTATCCGCGTGACGGAGGAGAAGCTCCGGGTTCTCCGGTCCGTGGTCGAGCGGCAGGCCGGC
GGCAGTGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62