GenePrediction:GLEAN_7848 Details

Name: GLEAN_7848
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2631340..2625287 (- strand)
Length: 6054
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2631340..2629422 (- strand)
Length: 1919
Type: CDS
Source: GLEAN
Position: GCSC_113:2629251..2628288 (- strand)
Length: 964
Type: CDS
Source: GLEAN
Position: GCSC_113:2627754..2627727 (- strand)
Length: 28
Type: CDS
Source: GLEAN
Position: GCSC_113:2627415..2626796 (- strand)
Length: 620
Type: CDS
Source: GLEAN
Position: GCSC_113:2626745..2626522 (- strand)
Length: 224
Type: CDS
Source: GLEAN
Position: GCSC_113:2626028..2625621 (- strand)
Length: 408
Type: CDS
Source: GLEAN
Position: GCSC_113:2625551..2625287 (- strand)
Length: 265
>GLEAN_7848 class=GenePrediction position=GCSC_113:2631340..2625287 (- strand)
ATGTCTTCCCAGTCGACGCCCTTGCGGCGCCGGCCCTCGACCAACGACGATCTCGCCCAGTCGATGCGCCACCTCTCGCT
CGCAGCAAAGCCGCCGGCCAAGCCGCCGACAACACGAAGCCCTTCAGCAGCATCGATGGCGTCGGTGGGCGGCCGTGCGT
ACCGGTCGCCAAGCGTGGCGAGCAGCCGCGGAGGAGGAGCAGCCTCAGCGATGGCGCAGCGCAGTCCGCTGCTGGGGAGC
GGACGGGAGTCGCGAGCAGGCGCGGCCACGCCGACGCTATTGCGCAAAGCATCACTAAACTCGCTGCACGGGGCCAACGG
CAAGACGAGCTCGGCGAACCTGCGGGCATCGTCGTGCTCGCCGGCACCGACGCAGAGACGGTCGCCGAGCGGACGGTCGG
CGGGCGGACGTTCGCCAGGCGGACTAAGCGCCAACGGAAGCAGCAGCAGCTTCTTTGAGCCGCTACCCGAAGAGCCGACG
GCCGAGTTCATCGCGCAGCAGCACTTTGAGGCCGAGCTGACACGCCACGCCGCCGATCTACGACAGCCGCTCGCGGCGCC
CGGCCACACCGACACGGTCGTCGTGCTGCAGGACAGCTGCTACGGCCACCGGTTCGCTCGGCCGCGTACATCGCGGGCCG
GCCTCAACACGATCGTCGAGCGCCCAGAACGGCTGCAGGCCTGCGTGGTCGGCGTGTCGGCGGCGTACGTGCGTCTGGGC
GGACGGCACGCCGGCGGCGCTCACATGCCGCATCCGCGGCGCAACGGCGGCGCCATCGCGTCCGTGCCCTTCCACATCCG
CAAGACCACGCGCCAGCTGCCGCTGCAGTCAGCCGCCGTCACCAACGTGCACGGGGCCAAGTGGATGGACGAGCTCAGGC
TGCTGTGCGAGTCGGCCGAAGCCAAGCTGGCGCTCAACGGCAAGGAGCTGCAGCGGGAGGGCAGCAGCAGCAGCGACACG
CCCGAGAAGCTGCACGAAGGCGACCTGTATCTGTGTGCCGAGTCGCTGGACGCGCTGCAGGGAGCGCTGGGGGGCGTATG
CGAGGCCGTGGACGCCGTCTTTGGCGGATCGCCCCCGCTGACACAAGACGAGCTAGGAGGACTGGGGTTGGGGCTGGCCC
TGCCGACCGAGAACCACAATACGGGACCGAAGCGGGCGTTTGTGGGCATCCGGCCGCCCGGACACCACTGCTCGGCGACG
TGGCCGTCGGGGTTCTGCTGGATCAACAACGTACACGTGGGGATCATGCATGCGATGCTGACGCACGGGCTGACACACGC
GGCGATTGTGGACTTTGATCTGCACCACGGCGACGGATCGCAGGCGGTGGCGTGGCAGCACAACGCGCGAGGCGTCGAGT
CGGGGCAGCGCGGTGGCAGCAGCAGCGGCAGTGGCAGCAGCAGCGCGGCAGCGACGTGGAAGAAGGCGTCGATTGGGTAC
TTCAGCCTGCACGACATCAACTCGTTTCCGTGCGAGTCAGGCGACGGCGACAAGGTGAAGAACGCGAGCATCTGCCTCGA
GAACGCGCACGGGCAGAACGTGTGGAACGTACACCTGGAGCGGTGGAAGACGGAGGCCGAGTTCTGGCGGCTGTACGAGA
CCAAGTACGTCGTGCTGCTGGACCGGGTGCGGGCCTTTCTGCGGGGGCAGACGGCACAGCGAACGGATGACAGGGCCGGT
GGCGAGCCCAAGGCGGCCATCTTCATCTCGGCGGGCTTTGACGCGAGCGAGTGGGAGACGCCCGGGATGCAGCGACACGA
GGTGAACGTGCCGACGGAGTTTTACGCACGATTCACGCGCGACATTGTACGGCTGGCCGACGAGGAGGGCACCTCGGCAG
ACGGACGGGTGATTAGCGTCCTGGAGGGTGGCTACAGCAACCGGGCGCTCATTTCGGGGGTGCTTAGCCATCTGAGTGGG
TTGGTGGGAGGGGGAGAAGCGGAGGGAAGAAGAGAGGAGAGGATGCGAAGCGACGAGGACGAAGAGAGAAGGATGCGAGG
TGACGAGGAGGACGAGGAGAGAAGGAGAGACTGCAACAACGACAAAATTCCCTCATACAATACCGCCTGGTGGACACCGT
CTGAACTAGATCGCATCGAGGCCATGATCGCGCCGCCGGCACCACCGACAGAAGGACACGTGGCCGTGAGCCAGCCGACG
ACGACGTACTCATCGCCGACGACGGCGTCCAAGGCCAAGGTAGCAATGCCGCGCGTCCGGCGCAGCGCATCCGGGCTGGC
AGCCACGTACGGCCGGGCGACGTCGCCGATGTCGCGACCACCAACACCACCGCCACCCGAGGTGTCGTGGACGGTGGCCA
TGCACGAGCTCAGCAAGCTGTTGATTCCGTGGGACCGGTCGACGACGAGCTGTACGGCCGAGGAGCTGACAGTCGAGACG
CCGCGGCGGCGAGGCGGCGGAGGAGGGGTGGCACAGTCGACAGGAGCACCGACGAGGACGTCACAGCGGGAACGACGGCC
GGTGAAGCCGTTTGGCACCGGCAGCGAGGAGGGAACGACGACACGAGGTCGACCCAAACAGCCGGTGCGACGGCTCAGCG
TGGCGTCAGAGATGGGCAGCAGCAGCAACAGCAGTGGCGCTACAGCAGGGTTGCATGTCCGCAAGACGCGACCGGCGACG
GCAATGGGCGTGACAACGACGACAGGTGGAAGACGGGAGACGTCGGTAGGTCCGAGGACGACAGCAACGAGTGCCACGAG
TGCTACTACCGCCACCAGAAGAAGCAGCACGTCGGTGCCCAGTGGCCGGACGACGTCCATGTCTTCAAGCCAGCCGACGA
GCGGCACGCGGCGGATCAAGATCAACGTGGTCACGACGGCACAGCGAGAGGCTCGAGAGGCTCGAGAAAAGACCAAACAA
GGTGGAGATGGTGCAGCTACCTCCTCGACCACCACGGACGAGTCGCCCCTGCTGACGCCCAGCACCGAGGCGGACAGCAC
GACGACGGCCACAAGCTCACGGTCGCCGTCAGCAATGCGACGTGCCGATCTGCCCCGGTTTACGGCCACGTCGACGATCC
CGTTTGCGCGAAAGTGAGCGGCAGAAGGTGGGATCCCTGCAGGGGAAGAGTGGGTTGGTGGATCGTTGATCGTTTTGCGT
TGATCGTTGATCGTGGATTCATCAATCGTTAATCGCTAATCGTTAATCGTTAATCGTAAAGTTCATCCTTGTCGTTTACG
ATGATTCGCTTGCCATGTCTTTGTTGGCTCTTGAACAAGCCTCCGTACTCGGTGCATTCCTATTCCAGCTCGCTTAGTCA
GGGCTGCGGGCAACACAAGGCCACAGGCGGGGCCTCGCACCTATGACGTCGAGGCTGCGGGCAGCCGTGTGTTGTGTGAG
GCCCAGAGGCCGTGGCACCAGACCACCGGATCGATTGCGTAGCACGGCCGCCCCTTTCTCCTTCCGAAGGAGGCAGCCGC
GCATATCTTGGCGCCTTCCCGCTGTTCAGCAGCTCGCCTCTCCTCTTTTCCGTCGCCCTTCCTCATCCTCTCTCTCTTCT
CTTTCCATCTCGCATCGTCCCATCCATCCTCACATCCATCTTTGTCAATTGACCTCTCTCGTCCAGGCTAAGCCAACCAT
GCCGTTCAGCAGCTGTACGTGTGATTAATCCGCATTGGTCTTTTGTCAAGGCGTCTTCTGCTCCTTTGCTCTTTCATTCC
TCGTCCGTCTCTGCTTCCTGTCTTCGTCTTCCATCTTTGCTCTCTTCAACCTCACTCCCTCTCTTCTCTCCTCTTACTAT
CTATCATCTCTTTCTCTCCTCTCCTCTCCTTCTCTCTTCTCCTTCTCTCCTCTCCTTCTCTCCTCTCCTTCTCTCCTCTC
CTTCTCTCCTCCTCTCCTTCTCTCCCTCTCTCTCTCTCACTCAATCTTTATCCTCCCCTCCCTTAAATCCCCGCTAACTC
CCCAGATAACCCGTTCGCCTATCGCGATGTCCGCTCTCACCGCGAGCTCGTCTCGTACCGCGTCCTCACGCTCGCCAGCT
GGGCCCTGGCTGTCGCCTTGTCCATCTACTACTCGGTGCGCAGCCCCCACGGCCACGGCAGTCACCGCATCGCCGACCAG
AACCACCGCCACCTGACCGGCTTCACCCTCAACATGGTCATCGTCTACGTCTACTGGGCCGGCCTCTTCACCTCGCAGGC
CGGCTACATCAACCGGCTCTTCTCGTCTACTGCCAGCACCTCCGCCGTCGCCGCTGCCGTCGGCTCGCACTTTATTCTGA
ACAACCTGCTGCACTCGGCCTTTGTCATGCTCTTTGTCACCGGCCACTTTGTCCTCGCCGAGATCGTCCTGGCCGCCAAC
TTTATCAACCTGTCTACCCTCAGCATGCGCCACCCCCTCGCCTCTCACCCGCTCGCCCTCGTCCACCTGCCCACCGTCGC
CGGTCCGCTCGCCTGGACCTTTGTTGCCCTCTTCTGGAACGGCGCCATCGCCGTGCCCCATGCCCACAGCCTCTTCGCCC
GCGTCACCGCTAATATCTTTGTCTGGTCCATCCTCGGCTACGGCTTGCTGTTCATCCTCCTCGGTGTACGTTCTCCTGTT
CTCTCTTTCGTCCTCTCCTTCACTAACACGCCCAGGACATCTCCATGGGATTCCTACTCTCTGTCCTTGCTGCCGCCCTC
GGCGTCGGCCAGTTCTTCATCCAGTTTATCGCCCTACAGTGGATCTTTGCCTTCTCCATCATGGCCACGCTCTTTGTCGC
CACCTTTGCCATTGCTGTGCCCCAGTGGACCGGCAGTGGCGACAACATTCTGGCCGTTGTCGTGAATGAGGACACTGAAC
GGGCACCTCTGCTCAACGAGTGAGCTTCCGGGAGGACGCTACCAGTGGAAATGGTAGCCTAATGAAAAAAAAAAGGGCAG
ACAATGGGAGTTGGAATGAGAATGAGAATAAAATTGAACGGTTTAGGAAACTAGTGCCGGAGATTGAATTGGATGAAAAC
AGAGTTTGGAAGCACTGGGATAATGGACGGAAGCAGAGCACAAATTGGCTCGCTACTGTATCTACAAGAGTTGAGAATCT
ACCTGAAGTTGTAGCTGATATTTGTTGAGTGACGTATGTACATACATATCGAAGTCTTATCTTATCACCAGCTTAAGCTT
TAGTGGATTTGAGCTCTTGGGCCTGAAAGACTTGAAAGACCTAAAGACCTGCTTTGTTCGTCCATGAGAATGGCATATCC
GCCATTCGTCACCAGCCCGCGCTATGATCCTGATCACAGTGGTGAGGGTTTCGGTAGCGATCAAGCCAGCGTCAGCAGTA
GCTTCTCGAACAGCCAGAGCGGCTTTTTCCAGCTCACCCACACCATCGACAGAATGGACAGCATCGACGGCACCGCCGAT
TCGTCGCTTTCCCTTTCCGAGCCTGCATGTCGGCACAGACATCTGTGATGTCACCCGCATTTATGCCCTTCTCGACGACG
GGTCTTGTGCTGGTCGTGCTGCTCCGCTCTCCCGCGGCCTGCCCTCTCAGACGAGGGCGGCTCGGCTTGTGCGCCGCCTT
CTGACGGCACAGGAGCTGCCACCACCGCAGCCGAGGACTGGCGGCCTGCTGCCGACGCTGCCGTCGTCGTCGTCGTCTGC
CGGACTGCTGGCCTGGCTGTTGGCCGGACACGTGACATCGACATCGACATCGAAATCGACCGACACAAAACGTCCACGCG
ATCCCACCCTCTGGAAGGCCGCTCAGTTCCTAGCAGGAAGGTATACACTCCTCGGCTAGACTCTCCAGTCCCTCTCGGCT
CTCTCACATCCCTCCTGACCCACTGCCAGATTCGCCGCCAAAGAGGCTGCCATCAAGGCACATCCTCATCTCAGCCTGAC
CTTTCACCAGATCCGCATCGTTCGCGCAAAGGACACGGAAAATAACGGCAGCGGACCGCCCGTTGCCCTCATCCAACTCC
CACCCTGCGCACATACTGGCACGGCTCCCGTCGAGCAGGAGGCGCGGCTCAGCATCAGCCACGATGGCACCTACGCCACT
GCAGTCTGCATCGGCTTTCAAGACTCATTAGTAGACCAACAGCATTCATTATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62