GenePrediction:GLEAN_7851 Details

Name: GLEAN_7851
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2605924..2604172 (- strand)
Length: 1753
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2605924..2605795 (- strand)
Length: 130
Type: CDS
Source: GLEAN
Position: GCSC_113:2605727..2605578 (- strand)
Length: 150
Type: CDS
Source: GLEAN
Position: GCSC_113:2605143..2605055 (- strand)
Length: 89
Type: CDS
Source: GLEAN
Position: GCSC_113:2604768..2604172 (- strand)
Length: 597
>GLEAN_7851 class=GenePrediction position=GCSC_113:2605924..2604172 (- strand)
ATGTCCTTGTTCAACAGGCGTGCCGGCGTCTGCGGGCTGCTGCTCGCGTCAGCATTGATCCCAAGAGCCCTTGGCAGCTC
GGTGCCAATAGTGTATTGTGCGAGCATCAATACCGCATCAACAAGTGCCAGTACGTCACTGCGATTCTCGGAGGCCTAAC
TGTTGTGTAGCTATTCTGACTCGTCGCCCTCTCATAGACAGCAGCATATACCAATCTGACGGGCTATGTTTGAATCTCTG
CGAGAGCAGTTATGCATATGCCATCGTGCATGGGGAGAACTGCTGGTGCTCTGACTATACACCCGCCTCCAGTGACCAGG
TGGACACGGACGAATGCGACATTGCTTGTCCAGGCTATCCGTCCGACACCTGTGGCGGCACTGGCCTGTACGGCTACATG
TCTGGTGACCAGAGCCCGTCCGGTACGAAAGGCGCATCATCATCAGCGGCAGCTTCTACCAAAGCATCCACCACGTCCAC
ATCTACGTCGACGTCTACCACTCCGACCACTACCGCTACTACATCCTCTACAACCTCGGTAAGTTCTAATGTGTTAATCA
GCGAGCAGTACCGGTGATCTATCGACGAGAACGTCGCATCTCCGTTGTCTTCGTGCCAGTAGCAGCTCCTATCCTATCTG
CCCTCGTGCCAGCCTCCCATGCCTGCATGCCGCCATTTTGCATATGTTGCTAGCCGCCACTAAGCCTGTGCTTTATTCCT
CTTCCGGTGAGATATTTTGAGGGTATAGCGCAGTTGCTGAACAACGTTGGAATACAACCAGATCGCACCTGTCACGACGA
CTGTTATTATAAGCGCCGAACCGATAACACCAACAACGTCGTCATCGTCCACATCTTCAACATTTTCAACGTCCACTAGT
AGTGTACGGCTCGCAACTTTCCCTTCTGTTCTGCATTTATCTCGCCTTGATTTATGCTTTTTGTTGTTGCTTGGCTTTAT
TATTGATGATCATCGTGACTTGACATGTCTATTTGTCGGCTTGGCACAAGGATAGGGGCTTTGGCACATTGAAACGTGAT
ATGTGACATATGTGACCATGTGACGGCAGTTTCTGCTGCGTTCCAGTCGAAATGGCGATGGTCATTTGCGTGCGAAGCTT
TGTTTTGGTCTTGCTGTTTGCTAACCTCTTCAACAGCAAAAAACGACGGAAACTCCTACGAAAACCCAGACTCCGACAGT
GCAGACCGTGACCACTGGTGGTGTTGTCCTGACTGTCACCGTGACGCCTAGTTCGGCATCGAGTCAGGTTTCTGCTGCAG
TGACCACCAAGAAGCACAAGAGCGTCAGCACGGGAGCCGCTGTTGGGATTGCCATTGGTGTGGTTGTCGGTGTGGTCTTG
GTTGCCGCAATAGCATTCTTGCTGTGGCGCCGCAAGCGACAGCAGAGCGAGAAGGATGAGGCCCTATTCGCTGCCACCAA
TTCTCCTTCGACTCGCGGCACGTCGCCTGGCACCATGAACGGCCTCAATGTAGCAGAGGCAGTCGGTGCGGCATCGTTCG
CACGCCATGGCGCCGACGGAAGCTGGGAGAGCGACCAGTCTGGCCGGCGCCGCAGCACGTTAATGCCGATTGACCCGCGT
ATCGACCCTGGTTTCACGGATATATACTCCCGCACCGACAACAAGAGCCGAGATAGCGTCAACTCTTTGCGCGATGACCA
CGATTACTCGAGGCGGGTTCACCAGCCGAACAAAGTGCTGCGTGCAACGAACCCAGACCCAGACGACGAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62