GenePrediction:GLEAN_7852 Details

Name: GLEAN_7852
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2601689..2599643 (- strand)
Length: 2047
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2601689..2601650 (- strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_113:2601589..2601433 (- strand)
Length: 157
Type: CDS
Source: GLEAN
Position: GCSC_113:2601361..2600935 (- strand)
Length: 427
Type: CDS
Source: GLEAN
Position: GCSC_113:2600881..2599643 (- strand)
Length: 1239
>GLEAN_7852 class=GenePrediction position=GCSC_113:2601689..2599643 (- strand)
ATGAATTTAACGTGCAATTCGACGTTGGACGACCTTCGGAGTAGGCTCCCTCCCTCCTTTCCTCTCCCTGGGCGCAGTGG
TTTTGTTTGCTGACCAACAGTCCTGCCGACGTCCGAGATCAAGATCGCTGGCCCGTTCACCTTCCACACCCTTGCCGAGG
TTATCTCTGCGGCATGCACGGCGATCGCGATTGCTATGAGCACGCTCCTGATCTTCCAGCATGCCCGGCACTACACCAAG
CCGGCTGAGCAGAAGCAGTGAGCCCGCCCTCGTCCTTGTTGTCCCGTGTCGGCGTGCTCTTTCACTGACGTTCCTCGGTT
GTTTCTAGCATCATCCGGATCCTCTTCATGGTCCCTGTATACGCGGCGTCTTCGTTGCTGTCTCTCCACTACTACTGGAA
CGCCATATACTTCCAGGTGATCAGCGACTGCTACGAGGCGTTTGCGATCTCGTCCTTCTTCGCGCTGCTCTGCGCCTACA
TCGATGTCGACCTCCACGAGCAAAAGAACTTTTTTCGCCAGATGCGACCGATCAAGGAGTGGGTCATGCCGGTGACCTAC
TTCAAGAAGTTCTGCGGTGGCGAGCGCGGGCCGTGGCGCACTCCGATCAGCGGCCTGACTTGGTTCAACATCATCTGGAT
CGGCATCTACCACTACTGTTTTATCCGGGTAGCGATGACGGTGACGGCGGTCGTGACGCAATACTATGGGCGCTACTGCG
AGAGCTCCAACAATCCGGTGTTTGCCCATGTCTGGGTAGGCCTCCGTCCCCGTCCCAGGTGTTCTTCTGGTCCGACTAAC
CGTGACAGATTCTCGTGATCAACTCGGTTGCCGTCACCATCGCCATGTACTGCGTGATTCAGTTCTACGTGCAGTTGCGC
ACGGCCTTGTCGGATCACTCGCCCTTTCTCAAGGTGCTTGCGATCAAGCTCGTCATCTTCCTCTCGTTCTGGCAGTCGAC
CATCATCTCGCTCGCGACGTCGTACAACATTGTGAAAGCGTCGGACATTATAGCGTACCCCGACATCAAGGTGGGCATCA
CATCGATGCTTCTGTGCGTGGAGATGGCAGCCTTTTCGATTCTGCATCTGTGGGCGTTCCCGTACCGGCCGTACATGGAC
TCGGCGCCTGCGACGTTTTACCCGGTGCCGGACCCGGATGCGTCGTACGCCATTCCGAAGCAGAATCTGCATCAGCCCCG
CAGTGGTGGATTTATGGGCCTCCGGGCGATCGGCGAGGCCCTCAACATCTGGGATGTGGCCAAGGCGTTTGGACGTGGGA
TCCGGTGGCTGTTTGTGGGCGTGCGACACCGGCGCGACGACGTCAGCTACCAGGCGCCGTACAAGACGCCGGAGATGGAC
ATGGACGAGCTGTCGGCGGATCACTTTAACGGGGCCAAGCAGGGATCTGTCCGTGTGGCAGCTGGCGGCGTGATGGCAGG
CGGAATCGACACGGCGTACCACCCGGGCCACCACCCGGGCCTGGCTGCGATGAAGGGCACAGAACCACTACCGATCGCGA
CGTCTTTGCGGCACAGCCGATTCAACACTCTGCACAGAGGCGGCAGCAGCAGCAGCAGCAGCGGCAGTTCAGGCGTGCTC
CGAGAGGGCGAAGGGAGCGGACCGAACGGTACGGCGCCAGGCAATCGGCGACAGCTCAGCGACGAGGCAGCAGGACTGAT
CGCATACGCACAGCCGATGTCAACGCATGGGCCCGAGGGCAGCCCCGAGCGGTACGGAGAAGCACGGCAAGGGGGGATGA
GAGAGGCGGTGTATCGGGATGTGGTGTACGAGGAAGAGCTTGAGCAGGGGGGCTACTACCAGGACGGATATGCACCGAGC
GGCTACAACCGGGGAGGCTATGGGCGGGGAGGCTACAACCAGGGTGGCTTTGGGCGGGGAGGCCACAACCAGGGCGGCCA
GGTAGCCGGGGGCTACAGCCGGGGAGGCTACAGTCAAGGGTCTTCTGGGCGGAGAGGGAGTCAGGCAAGAGGAGGACAGG
CCGACGACTCGCCGCCGCCCGGAATGCGATGGGGAGAGGCCAGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62