GenePrediction:GLEAN_7853 Details

Name: GLEAN_7853
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2590581..2588856 (- strand)
Length: 1726
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2590581..2590558 (- strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_113:2590452..2590073 (- strand)
Length: 380
Type: CDS
Source: GLEAN
Position: GCSC_113:2590008..2588856 (- strand)
Length: 1153
>GLEAN_7853 class=GenePrediction position=GCSC_113:2590581..2588856 (- strand)
ATGGAGTACCCCGGCCACGCTATGGTTAGTAGCTCTCCCATCTCAAACGGTGTCTTGTTCGCTGCTGCTCATCCTCCCTC
CTTTGCTTTGGAAGAATGGTTGCTGAATACCGGGTAAGAAAGAACACAGGGGCAACCCGAAAACCCGTTTGCGGCCCTGA
TCCCGGACCAGCAGTTTGCCATCGTGCCATCCTTCCAGCTTGAGTCGGGCGTAGCTCTTCAGAATGTGCCCGTGGCATAT
ACAACACGAGGCACGCTCTCGCCGGACGGCTCAAATGCCATGGTCATCTGCCATGCGCTCACCGGCAGTGCTGACGTGGG
CGACTGGTGGGGCCCTCTTCTGGGCGGTCCAGGGCGAGCCTTTGATGTCTCTCGCTTCTTCATCATCTGCCTCAACAGTC
TTGGCAGTCCGTACGGATCGGCCAGCCCGGTGACGGCCAAGGACGGCGACCCGAGCAGAGGCCGCTACGGACCCGAATTC
CCGTTGACAACCATCCGCGATGACGTCCGGTAGGTCTATTGGAGGCGTGCTGTCCCATGTGCTTGCCAGGTTCTGACCGT
CTCCTGCGTCTAGGCTACACAAGATGGTGCTGGACGACTTGGGCGTGCGCCAGGTGGCTGCCGTCATCGGCGGCTCGCTC
GGCGGCATGTTTGTGCTCGAGTGGGCGTATCTGGGACGAGATTACGTGCGCAGCATTGTGCCGATCGCGACGAGCAGCCG
GCACAGCGCATGGGGCATCAGCTGGGGCGAGGCGCAGCGACAGAGCATCTACGCGGACCCCAAGTACGAAGACGGCTACT
ATCCGTTTGACGATCCGCCGGCAGCAGGACTGGGAGCGGCGCGCATGTCGGCGCTGCTGACGTATCGCAGCCGCAACTCG
TTTGAGGCGCGCTTCGGACGCAACATCCCCGACCCCAAGCGCAAGCAGACGATCCTGGAGGGCGAGCGGAAGTCGTCTCC
AGCCGGCTCAGACGCGCCGAGCTCTCCGTCCGAGGGCCACTTCCGCATCCACAACGACGGCCACCGGATCCGGGAGGACC
GGTTCCTGCGGAGATCCTCTTCGGGTGGCGATGTGACGCTGGACCCGCAGTTCCACGGGCCCGGCCAGGATGCGATCGCC
AGCAACGGCAGCGGAAACGACAGCACCCACACATCGACGGCAGCGTCGACGGCGACGACAACAAACGCCATCGTCCCGTC
TCCGCCCAAGGAGAGTCTCACGGGCGGCGTGCAGGTGGTGCCGACGTCGACGTACTTCTCGGCACAGTCGTACCTCCGGT
ACCAGGCAGCCAAGTTCGTGCGACGGTTCGACAGCAACTGCTACATTGCCATGACGCGCAAGCTGGATACGCATGACGTG
TCGCGCAGCCGGGCCAACACGGTAGCAGATGCGCTGGCGATGATCGAGCAGCCGACGCTGGTGCTGGGCATCGAGAGTGA
CGGGCTCTTCACCTTCGCCGAGCAGGAGGAGCTGGCAGAACACATTGGGGACGCGCGACTCGAGCGCATCGACAGCCCTG
AGGGCCACGACGCCTTTCTGCTGCAGTTCGAGCAGGTCAACCGATACATTCTCGCATTTCTGCGCGAGGTGCTACCGGAC
ATTATGAGCCGCGAGGGCAGCAGCATCGCTGGGGCTGGCGCCGAGGTCGACGGCGGCTCGGTCGGACAGCTGACAAAGTC
GAGCGTGTTTGGTGAGGCAGAAGTGGAAGACATCACGGCATGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62